Primers for Hin gene with LVA degredation tag
From 2006.igem.org
(Difference between revisions)
Fizzle6821 (Talk | contribs) |
|||
| Line 4: | Line 4: | ||
'''Forward Primer''' | '''Forward Primer''' | ||
| - | *Consists of | + | *Consists of <font color='blue'>four base pairs from plasmid pSB1A2 [http://partsregistry.org/Part:pSB1A2]</font color><font color='green'>BioBrick prefix</font color>, and<font color='orange'> the first three base pairs of the Hin gene</font color>[http://partsregistry.org/Part:pSB1A2] |
<font face="courier new"><font color='blue'>TCTG</font color><font color='green'>GAATTCGCGGCCGCATCTAGAG</font color><font color='orange'>ATG</font color></font face> | <font face="courier new"><font color='blue'>TCTG</font color><font color='green'>GAATTCGCGGCCGCATCTAGAG</font color><font color='orange'>ATG</font color></font face> | ||
Revision as of 18:37, 12 June 2006
Hin gene with LVA degredation tag
Will have the following primers synthesized so that the Hin gene has a LVA degredation tag. PCR using these primers should take place after the Mutant Hin has already been transformed.
Forward Primer
- Consists of four base pairs from plasmid pSB1A2 [http://partsregistry.org/Part:pSB1A2]BioBrick prefix, and the first three base pairs of the Hin gene[http://partsregistry.org/Part:pSB1A2]
TCTGGAATTCGCGGCCGCATCTAGAGATG
Reverse Primer
- Consists of the Bio Brick suffix, Stop codon, LVA tag and the ,last 20 base pairs of the Hin gene (without the stop codon)
CTGCAGGCGGCCGCTACTAGTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC
