Biobricks
From 2006.igem.org
(Difference between revisions)
(23 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
- | + | == Construction So Far == | |
- | '' | + | === Devices Created === |
- | '' | + | {| border="1" |
+ | |- | ||
+ | | '''Parts''' || '''Part No.''' || '''Function''' || '''Status''' | ||
+ | |- | ||
+ | | E. coli ArsR to LacZ || J33203 || pH lowering output in response to raised arsenate concentration || Working | ||
+ | |- | ||
+ | | B. subtilis ArsR to LacZ || J33206 || As Above || Background activity too high | ||
+ | |- | ||
+ | | B. subtilis ArsR to lambda cI repressor || n/a|| To repress the hybrid promoter in response to lower levels of arsenate || Done but untested | ||
+ | |- | ||
+ | | GFP to Terminator || n/a || Testing ArsR function if can't get pH response || Done but not ligated to either ArsR | ||
+ | |- | ||
+ | |} | ||
- | === ArsR | + | === Biobricks Constructed By Us === |
+ | {| border="1" | ||
+ | |- | ||
+ | | '''Biobrick''' || '''Part No.''' || '''Construction''' || '''Ligations''' || '''Testing''' || '''Sequencing''' || '''Use''' | ||
+ | |- | ||
+ | | E. coli ArsR || J33201 || Complete || To LacZ || Working || Done || Detection of Arsenic | ||
+ | |- | ||
+ | | B. subtilis ArsR || n/a || Complete || To LacZ || Tests Underway || biobrick suffix not correct, not in biobrick form || Detection of Arsenic | ||
+ | |- | ||
+ | | LacZ' || J33202 || Complete || To ArsR and Terminator || Working || Done || Lowering pH/Reporting | ||
+ | |- | ||
+ | | Bacillus Urease || n/a || Site specific mutagenesis required to remove EcoRI and SpeI sites || To ligate to hybrid promoter || N/A || Not Yet || Raising pH | ||
+ | |- | ||
+ | | lambda cI/lacI Promoter || J33205 || Complete || To ligate to urease || Planned || Done || Repressed by lambda cI and lacI in absence of lactose | ||
+ | |- | ||
+ | |} | ||
+ | === Parts constructed but not used === | ||
+ | {| border="1" | ||
+ | |- | ||
+ | | '''Biobrick''' || '''Part No.''' || '''Function''' || | ||
+ | |- | ||
+ | | xylE from Psuedomonas putida || J33204 || Reporter converting catechol to yellow colour | ||
+ | |- | ||
+ | |} | ||
- | '' | + | === Biobricks Taken From Registry === |
+ | {| border="1" | ||
+ | |- | ||
+ | | '''Biobrick''' || '''Number and Location''' || '''Ligations''' || '''Testing''' || '''Use''' | ||
+ | |- | ||
+ | | Terminator || BBa_B0015, 1I || To LacZ, plasmid used as vector for most ligations || N/A || Terminating | ||
+ | |- | ||
+ | | RBS || BBa_B0034, 3O || To ArsR from E. coli || N/A || Ribosome binding site | ||
+ | |- | ||
+ | | lambda cI || BBa_R0051, 9C || Not yet || Not yet || Repressing hybrid promoter | ||
+ | |- | ||
+ | | GFP || BBa_E0040, 5H || To Terminator || Not Yet || Testing Promoters | ||
+ | |- | ||
+ | |} | ||
+ | == Primers Etc. == | ||
- | + | All biobricks have to have the following: | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | '' | + | ''Prefix'' |
+ | (5’) <font color='red'> cctttctagag </font> (3’) | ||
- | + | ''Suffix'' | |
+ | (5’) <font color='red'> tactagtagcggccgctgcagcctt </font> (3’) | ||
- | '' | + | === Primers used in our procedures === |
+ | {| border="1" | ||
+ | |- | ||
+ | | '''Name''' || '''Sequence''' || '''Use''' || '''Worked?''' || '''Sites''' | ||
+ | |- | ||
+ | | Ecarsf1||cctttctagagccaactcaaaattcac ||''E. coli arsR ''for J33201|| yes || XbaI | ||
+ | |- | ||
+ | | Ecarsr1||aaggctgcagcggccgctactagtacccggataaaacacatc ||''E. coli arsR ''for J33201|| yes || SpeI, NotI, PstI | ||
+ | |- | ||
+ | | laczf1||cctttctagaggaggaaacagctatgacc ||''E. coli lacZ' ''for J33202|| yes || XbaI | ||
+ | |- | ||
+ | | laczr1||aaggctgcagcggccgctactagtatcactccagccagctttc ||''E. coli lacZ' ''for J33202|| yes || SpeI, NotI, PstI | ||
+ | |- | ||
+ | | laczf2||ggtctagagctcatgttatatcccg ||''E. coli lacZ' ''for J33207|| yes || XbaI, SacI | ||
+ | |- | ||
+ | | Bsarsf2||atgagctccgttgctgtagtagc ||''B. subtilis arsR '' for J33206|| yes || SacI | ||
+ | |- | ||
+ | | Bsarsr2||aaactagtttagcagcaatctccttc ||''B. subtilis arsR '' for J33206|| yes || SpeI | ||
+ | |- | ||
+ | | Ppxylef2||ctgagctcatgaactatgaagaggtg ||''P. putida xylE '' for J33204|| yes || SacI | ||
+ | |- | ||
+ | | Ppxyler2||taactagtaccggaccatcaggtc ||''P. putida xylE ''for J33204|| yes || SpeI | ||
+ | |- | ||
+ | | Bsuref1||gagagctccgcaaattcgtagtagc ||''B. subtilis ureABC ''|| yes || SacI | ||
+ | |- | ||
+ | | Bsurer1||ctggatccatgggttttgtgcaccg ||''B. subtilis ureABC ''|| yes || BamHI | ||
+ | |- | ||
+ | | JAlam2(f)||gtggagctccgttaaatctatcaccgc ||lambda PRM-PR region|| yes || SacI | ||
+ | |- | ||
+ | | JAlam1(r)||catctcgagattatcaccgccagagg ||lambda PRM-PR region|| yes || XhoI | ||
+ | |- | ||
+ | | JAlac2(f)||gttctcgagaattgtgagcggataac ||''lac'' cI binding site|| yes || XhoI | ||
+ | |- | ||
+ | | BBinsf1||attcgcggccgcttctag ||sequencing biobrick inserts|| yes || N/A | ||
+ | |- | ||
+ | | BBinsr1||tgcagcggccgctactag ||sequencing biobrick inserts|| yes || N/A | ||
+ | |- | ||
+ | | Bsure1r1||tcctctagagagaccgttttctgctctc ||mutating SpeI site in ''ureABC''|| yes || XbaI | ||
+ | |- | ||
+ | | Bsure2f1||aaaacggtctcactagtgg ||mutating SpeI site in ''ureABC''|| yes || SpeI | ||
+ | |- | ||
+ | | Bsure2r1||catctcgagcttgctcagctttctg ||mutating EcoRI site in ''ureABC''|| yes || XhoI | ||
+ | |- | ||
+ | | Bsure3f2||aagctcgagatgaagctgaactcggctttg ||mutating EcoRI site in ''ureABC''|| see notes || XhoI | ||
+ | |- | ||
+ | | Bsure3r2||tacactagttttgtgcaccgtttttag ||''ureABC''|| yes || SpeI | ||
+ | |- | ||
+ | |} | ||
- | + | [http://2006.igem.org/University_of_Edinburgh_2006 Main page] | |
+ | __NOTOC__ |
Latest revision as of 14:19, 29 October 2006
Construction So Far
Devices Created
Parts | Part No. | Function | Status |
E. coli ArsR to LacZ | J33203 | pH lowering output in response to raised arsenate concentration | Working |
B. subtilis ArsR to LacZ | J33206 | As Above | Background activity too high |
B. subtilis ArsR to lambda cI repressor | n/a | To repress the hybrid promoter in response to lower levels of arsenate | Done but untested |
GFP to Terminator | n/a | Testing ArsR function if can't get pH response | Done but not ligated to either ArsR |
Biobricks Constructed By Us
Biobrick | Part No. | Construction | Ligations | Testing | Sequencing | Use |
E. coli ArsR | J33201 | Complete | To LacZ | Working | Done | Detection of Arsenic |
B. subtilis ArsR | n/a | Complete | To LacZ | Tests Underway | biobrick suffix not correct, not in biobrick form | Detection of Arsenic |
LacZ' | J33202 | Complete | To ArsR and Terminator | Working | Done | Lowering pH/Reporting |
Bacillus Urease | n/a | Site specific mutagenesis required to remove EcoRI and SpeI sites | To ligate to hybrid promoter | N/A | Not Yet | Raising pH |
lambda cI/lacI Promoter | J33205 | Complete | To ligate to urease | Planned | Done | Repressed by lambda cI and lacI in absence of lactose |
Parts constructed but not used
Biobrick | Part No. | Function | |
xylE from Psuedomonas putida | J33204 | Reporter converting catechol to yellow colour |
Biobricks Taken From Registry
Biobrick | Number and Location | Ligations | Testing | Use |
Terminator | BBa_B0015, 1I | To LacZ, plasmid used as vector for most ligations | N/A | Terminating |
RBS | BBa_B0034, 3O | To ArsR from E. coli | N/A | Ribosome binding site |
lambda cI | BBa_R0051, 9C | Not yet | Not yet | Repressing hybrid promoter |
GFP | BBa_E0040, 5H | To Terminator | Not Yet | Testing Promoters |
Primers Etc.
All biobricks have to have the following:
Prefix
(5’) cctttctagag (3’)
Suffix
(5’) tactagtagcggccgctgcagcctt (3’)
Primers used in our procedures
Name | Sequence | Use | Worked? | Sites |
Ecarsf1 | cctttctagagccaactcaaaattcac | E. coli arsR for J33201 | yes | XbaI |
Ecarsr1 | aaggctgcagcggccgctactagtacccggataaaacacatc | E. coli arsR for J33201 | yes | SpeI, NotI, PstI |
laczf1 | cctttctagaggaggaaacagctatgacc | E. coli lacZ' for J33202 | yes | XbaI |
laczr1 | aaggctgcagcggccgctactagtatcactccagccagctttc | E. coli lacZ' for J33202 | yes | SpeI, NotI, PstI |
laczf2 | ggtctagagctcatgttatatcccg | E. coli lacZ' for J33207 | yes | XbaI, SacI |
Bsarsf2 | atgagctccgttgctgtagtagc | B. subtilis arsR for J33206 | yes | SacI |
Bsarsr2 | aaactagtttagcagcaatctccttc | B. subtilis arsR for J33206 | yes | SpeI |
Ppxylef2 | ctgagctcatgaactatgaagaggtg | P. putida xylE for J33204 | yes | SacI |
Ppxyler2 | taactagtaccggaccatcaggtc | P. putida xylE for J33204 | yes | SpeI |
Bsuref1 | gagagctccgcaaattcgtagtagc | B. subtilis ureABC | yes | SacI |
Bsurer1 | ctggatccatgggttttgtgcaccg | B. subtilis ureABC | yes | BamHI |
JAlam2(f) | gtggagctccgttaaatctatcaccgc | lambda PRM-PR region | yes | SacI |
JAlam1(r) | catctcgagattatcaccgccagagg | lambda PRM-PR region | yes | XhoI |
JAlac2(f) | gttctcgagaattgtgagcggataac | lac cI binding site | yes | XhoI |
BBinsf1 | attcgcggccgcttctag | sequencing biobrick inserts | yes | N/A |
BBinsr1 | tgcagcggccgctactag | sequencing biobrick inserts | yes | N/A |
Bsure1r1 | tcctctagagagaccgttttctgctctc | mutating SpeI site in ureABC | yes | XbaI |
Bsure2f1 | aaaacggtctcactagtgg | mutating SpeI site in ureABC | yes | SpeI |
Bsure2r1 | catctcgagcttgctcagctttctg | mutating EcoRI site in ureABC | yes | XhoI |
Bsure3f2 | aagctcgagatgaagctgaactcggctttg | mutating EcoRI site in ureABC | see notes | XhoI |
Bsure3r2 | tacactagttttgtgcaccgtttttag | ureABC | yes | SpeI |
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]