Biobricks

(Difference between revisions)

Revision as of 10:32, 21 August 2006

Biobrick	Construction	Ligations	Testing	Sequencing	Use
E. coli ArsR	Complete	To LacZ	Not Working	Not Yet	Detection of Arsenic
B. subtilis ArsR	Complete	To LacZ	Not Tested	Not Yet	Detection of Arsenic
LacZ	Complete	To ArsR and Terminator	Tests Underway	Not Yet	Lowering pH/Reporting
Bacillus Urease	Site specific mutagenesis required	To ligate to hybrid promoter	N/A	Not Yet	Raising pH
lambda cI/lacI Promoter	Underway	To ligate to urease	N/A	Not yet	Repressed by lambda cI and lacI in absence of lactose

Biobrick	Number and Location	Ligations	Testing	Use
Terminator	BBa_B0015, 1I	To LacZ, plasmid used as vector for most ligations	N/A	Terminating
RBS	BBa_B0034, 3O	To ArsR from E. coli	N/A	Ribosome binding site
lambda cI	BBa_R0051, 9C	Not yet	Not yet	Repressing hybrid promoter

All biobricks have to have the following:

Prefix

(5’) cctttctagag (3’)

Suffix

(5’) tactagtagcggccgctgcagcctt (3’)

@@ Line 32: / Line 32: @@
 == Primers Etc. ==
 All biobricks have to have the following:
 ''Prefix''
 (5’) <font color='red'> cctttctagag </font> (3’)
 ''Suffix''
 (5’) <font color='red'> tactagtagcggccgctgcagcctt </font> (3’)
-=== ArsR with Ribosome Binding Site Biobrick ===
-''Front primer sequence with Biobrick prefix''
-(5’) <font color='red'> cctttctagag ccaactcaaaattcacac </font>  (3’)
-''Back primer sequence with Biobrick suffix''
-(5’) <font color='red'> tactagtagcggccgctgcagcctt catatgtgtttagc </font> (3’)
-=== LacZ with Ribosome Binding Site Biobrick ===
-''Front primer sequence with Biobrick prefix''
-(5’) <font color='red'> cctttctagag gaaacagctatgaccatg </font> (3’)
-''Back primer sequence with Biobrick suffix''
-(5’) <font color='red'> tactagtagcggccgctgcagcctt gaggggacgacgacag </font> (3’)
 [http://2006.igem.org/University_of_Edinburgh_2006 Main page]
 __NOTOC__