Biobricks
From 2006.igem.org
Construction So Far
Biobricks Constructed By Us
Biobrick | Construction | Ligations | Testing | Sequencing | Use |
E. coli ArsR | Complete | To LacZ | Not Working | Not Yet | Detection of Arsenic |
B. subtilis ArsR | Complete | To LacZ | Not Tested | Not Yet | Detection of Arsenic |
LacZ | Complete | To ArsR and Terminator | Tests Underway | Not Yet | Lowering pH/Reporting |
Bacillus Urease | Site specific mutagenesis required | To ligate to hybrid promoter | N/A | Not Yet | Raising pH |
lambda cI/lacI Promoter | Underway | To ligate to urease | N/A | Not yet | Repressed by lambda cI and lacI in absence of lactose |
Biobricks Taken From Registry
Biobrick | Number and Location | Ligations | Testing | Use |
Terminator | BBa_B0015, 1I | To LacZ, plasmid used as vector for most ligations | N/A | Terminating |
RBS | BBa_B0034, 3O | To ArsR from E. coli | N/A | Ribosome binding site |
lambda cI | BBa_R0051, 9C | Not yet | Not yet | Repressing hybrid promoter |
Primers Etc.
All biobricks have to have the following:
Prefix
(5’) cctttctagag (3’)
Suffix
(5’) tactagtagcggccgctgcagcctt (3’)