Davidson Parts
From 2006.igem.org
Fizzle6821 (Talk | contribs) |
|||
| Line 11: | Line 11: | ||
5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac 3’ | 5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac 3’ | ||
| + | '''''Hin gene with LVA degredation tag''''' | ||
| + | Will have the following primers synthesized so that the Hin gene has a LVA degredation tag. | ||
| + | |||
| + | '''Forward Primer''' | ||
| + | *Consists of a <font color='green'>BioBrick prefix</font color>, <font color='blue'>four base pairs from plasmid pSB1A2 [http://partsregistry.org/Part:pSB1A2]</font color>, and<font color='orange'> the first three base pairs of the Hin gene</font color> | ||
| + | <font face="courier new"><font color='blue'>TCTG</font color><font color='green'>GAATTCGCGGCCGCATCTAGAG</font color><font color='orange'>ATG</font color></font face> | ||
| + | |||
| + | '''''Reverse Primer''''' | ||
| + | *Consists of the <font color='green'>Bio Brick suffix</font color>,<font color='red'> Stop codon</font color>, <font color='purple'>LVA tag</font color> and the ,<font color='orange'>last 20 base pairs of the Hin gene</font color> (without the stop codon) | ||
| + | |||
| + | <font face="courier new"><font color='green'>CTGCAGGCGGCCGCTACTAGT</font color><font color='red'>ATT</font color><font color='purple'>AAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGC</font color><font color='orange'>ATTCATTCGTTTTTTTATAC</font color></font face> | ||
| + | |||
| + | |||
| + | [Recombinational Enahancer: Part BBa_J3101] | ||
'''''Recombinational Enhancer: Part BBa_J3101''''' | '''''Recombinational Enhancer: Part BBa_J3101''''' | ||
Revision as of 18:29, 12 June 2006
Hin gene: Part BBa_J31000
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in bold.
Forward primer
5’ gcattctagaatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttacCagtgcaaattg 3’
Reverse primer
5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac 3’
Hin gene with LVA degredation tag
Will have the following primers synthesized so that the Hin gene has a LVA degredation tag.
Forward Primer
- Consists of a BioBrick prefix, four base pairs from plasmid pSB1A2 [1], and the first three base pairs of the Hin gene
TCTGGAATTCGCGGCCGCATCTAGAGATG
Reverse Primer
- Consists of the Bio Brick suffix, Stop codon, LVA tag and the ,last 20 base pairs of the Hin gene (without the stop codon)
CTGCAGGCGGCCGCTACTAGTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC
[Recombinational Enahancer: Part BBa_J3101]
Recombinational Enhancer: Part BBa_J3101
These are the oligos that we ordered to make the recombinational enhancer.
AATTCGCGGCCGCTTCTAGATTCGGGTGTCAACAATTGACCAAAATAT
CGATTTACAGCGTAATGCGCTTTCTAGTGCAAATTGTGACCGC
ATTTTACTAGTTGCGGCCGCCTGCA
GGCGGCCGCAACTAGTAAAATGCGGTCACAATTTGCACTAGAA
AGCGCATTACGCTGTAAATCGATATTTTGGTCAATTGTTGACACCCGAATCTAGAAGCGGCCGCG
