Davidson Parts

From 2006.igem.org

Revision as of 19:53, 6 June 2006 by Fizzle6821 (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site.

Forward primer 5’ gcattctagaatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttacCagtgcaaattg 3’

Reverse primer 5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac 3’

Personal tools
Past/present/future years