IGEM 2005 Awards

From 2006.igem.org

Revision as of 16:13, 7 November 2005

The following awards were given out at the 2005 Jamboree

+Princeton ++Best Plasmid Naming Scheme ++Best "Show Must Go On" Moment ++Best Honest Answer ++Best Simulation of a Simulation

+Oklahoma ++Best "Hail Mary" Cloning ++Best "Quantitative" Answer ++Feynman's Teaching Award

+ETH ++Best Wiki Award ++Most Sensitive Super Model Award ++Precision Engineering Award

+MIT ++Most Modest Goal ++Least Transportable Visual Aid ++Best Analogy ++Second Most Parts Award

+Caltech ++Best Use of Transmogrified Smiley Faces ++Best New Application Area ++Best New New Foundational Research Area ++Chuck D.'s Choice Award

+Toronto ++Best Project Name (Cell-See-Us) ++Most Direct Use of Logic ++Best Advice ++Nothing-Will-Stop-Us Award

+Cambridge ++Most Effective Approach ++Best Master of Ceremonies ++Marshall Cultural Exchange Award ++Best Data & Data Visuals ++Best Uniforms

+Texas ++Best Confession / Negative Control (One Year Late) ++Best Live Demo, Again ++Best Model-Driven Design ++Best Proposed Funding Mechanism

+Penn State ++Best Brick Award (BBa_S03271, MotB) ++Best New Sport (Beijing 2008 or bust!) ++Best Use of Metaphor

+Berkeley ++Red-Eye Award ++XXXtreme Presentation ++Best Conceptual Advance ++Most Innovative Brick Award (BBa_J01002)

+Davidson ++Best Team Name (SynthAces) ++Best Debuggers ++Best Interface Logic

+Harvard ++Best Part Numbers ++Most Organized Presentation ++Best Technology Integration Award ++Most Parts Award ++Best TAATACGACTCACTATAGGGAGA Award ++Best Use of Redundancy

+UCSF ++Coolest Part ++Most Innovative Abuse of Expensive Laboratory Equipment ++Best Device Award ++Most Thoughtful Approach

Highlights (some of the things that worked)

+Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch) +Texas - Working and improved bacterial photography and signal processing device (built from BioBricks) +Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet) +MIT - Iron-induced control of any BioBrick device +Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB) +Harvard - write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires." +UCSF - wanted biological temperature detector, got a programmable biological thermometer