IGEM 2005 Awards

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
 
(8 intermediate revisions not shown)
Line 1: Line 1:
 +
The following awards were given out at the 2005 Jamboree by the [[Awards Panel]]
 +
*Princeton
 +
**Best Plasmid Naming Scheme
 +
**Best "Show Must Go On" Moment
 +
**Best Honest Answer
 +
**Best Simulation of a Simulation
 +
*Oklahoma
 +
**Best "Hail Mary" Cloning
 +
**Best "Quantitative" Answer
 +
**Feynman's Teaching Award
-
Princeton
+
*ETH
-
Best Plasmid Naming Scheme
+
**Best Wiki Award
-
Best "Show Must Go On" Moment
+
**Most Sensitive Super Model Award
-
Best Honest Answer
+
**Precision Engineering Award
-
Best Simulation of a Simulation
+
**George W. Bush Geography Award
-
Oklahoma
+
*MIT
-
Best "Hail Mary" Cloning
+
**Most Modest Goal
-
Best "Quantitative" Answer
+
**Least Transportable Visual Aid
-
Feynman's Teaching Award
+
**Best Analogy
 +
**Second Most Parts Award
 +
**IKEA Idea Award
-
ETH
+
*Caltech
-
Best Wiki Award
+
**Best Use of Transmogrified Smiley Faces
-
Most Sensitive Super Model Award
+
**Best New Application Area
-
Precision Engineering Award  
+
**Best New New Foundational Research Area
 +
**Chuck D.'s Choice Award
-
MIT
+
*Toronto
-
Most Modest Goal
+
**Best Project Name (Cell-See-Us)
-
Least Transportable Visual Aid
+
**Most Direct Use of Logic
-
Best Analogy
+
**Best Advice
-
Second Most Parts Award
+
**Nothing-Will-Stop-Us Award
-
Caltech
+
*Cambridge
-
Best Use of Transmogrified Smiley Faces
+
**Most Effective Approach
-
Best New Application Area
+
**Best Master of Ceremonies
-
Best New New Foundational Research Area
+
**Marshall Cultural Exchange Award
-
Chuck D.'s Choice Award
+
**Best Data & Data Visuals
 +
**Best Uniforms
-
Toronto
+
*Texas
-
Best Project Name (Cell-See-Us)
+
**Best Confession / Negative Control (One Year Late)
-
Most Direct Use of Logic
+
**Best Live Demo, Again
-
Best Advice
+
**Best Model-Driven Design
-
Nothing-Will-Stop-Us Award
+
**Best Proposed Funding Mechanism
-
Cambridge
+
*Penn State
-
Most Effective Approach
+
**Best Brick Award (BBa_S03271, MotB)
-
Best Master of Ceremonies
+
**Best New Sport (Beijing 2008 or bust!)
-
Marshall Cultural Exchange Award  
+
**Best Use of Metaphor
-
Best Data & Data Visuals
+
-
Best Uniforms
+
-
Texas
+
*Berkeley
-
Best Confession / Negative Control (One Year Late)
+
**Red-Eye Award
-
Best Live Demo, Again
+
**XXXtreme Presentation
-
Best Model-Driven Design
+
**Best Conceptual Advance
-
Best Proposed Funding Mechanism
+
**Most Innovative Brick Award (BBa_J01002)
-
Penn State
+
*Davidson
-
Best Brick Award (BBa_S03271, MotB)
+
**Best Team Name (SynthAces)
-
Best New Sport (Beijing 2008 or bust!)
+
**Best Debuggers
-
Best Use of Metaphor
+
**Best Interface Logic
-
Berkeley
+
*Harvard
-
Red-Eye Award
+
**Best Part Numbers
-
XXXtreme Presentation  
+
**Most Organized Presentation  
-
Best Conceptual Advance
+
**Best Technology Integration Award
-
Most Innovative Brick Award (BBa_J01002)
+
**Most Parts Award
 +
**Best TAATACGACTCACTATAGGGAGA Award
 +
**Best Use of Redundancy
-
Davidson
+
*UCSF
-
Best Team Name (SynthAces)
+
**Coolest Part
-
Best Debuggers
+
**Most Innovative Abuse of Expensive Laboratory Equipment
-
Best Interface Logic
+
**Best Device Award
 +
**Most Thoughtful Approach
-
Harvard
+
==Highlights (some of the things that worked)==
-
Best Part Numbers
+
*Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch)
-
Most Organized Presentation
+
*Texas - Working and improved bacterial photography and signal processing device (built from BioBricks)
-
Best Technology Integration Award
+
*Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet)
-
Most Parts Award
+
*MIT - Iron-induced control of any BioBrick device
-
Best TAATACGACTCACTATAGGGAGA Award
+
*Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB)
-
Best Use of Redundancy
+
*Harvard - Write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires."
-
 
+
*UCSF - Wanted biological temperature detector, got a programmable biological thermometer
-
UCSF
+
-
Coolest Part
+
-
Most Innovative Abuse of Expensive Laboratory Equipment
+
-
Best Device Award
+
-
Most Thoughtful Approach
+
-
 
+
-
Highlights (some of the things that worked)
+
-
Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch)
+
-
Texas - Working and improved bacterial photography and signal processing device (built from BioBricks)
+
-
Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet)
+
-
MIT - Iron-induced control of any BioBrick device
+
-
Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB)
+
-
Harvard - write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires."
+
-
UCSF - wanted biological temperature detector, got a programmable biological thermometer
+

Latest revision as of 12:03, 24 November 2005

The following awards were given out at the 2005 Jamboree by the Awards Panel

  • Princeton
    • Best Plasmid Naming Scheme
    • Best "Show Must Go On" Moment
    • Best Honest Answer
    • Best Simulation of a Simulation
  • Oklahoma
    • Best "Hail Mary" Cloning
    • Best "Quantitative" Answer
    • Feynman's Teaching Award
  • ETH
    • Best Wiki Award
    • Most Sensitive Super Model Award
    • Precision Engineering Award
    • George W. Bush Geography Award
  • MIT
    • Most Modest Goal
    • Least Transportable Visual Aid
    • Best Analogy
    • Second Most Parts Award
    • IKEA Idea Award
  • Caltech
    • Best Use of Transmogrified Smiley Faces
    • Best New Application Area
    • Best New New Foundational Research Area
    • Chuck D.'s Choice Award
  • Toronto
    • Best Project Name (Cell-See-Us)
    • Most Direct Use of Logic
    • Best Advice
    • Nothing-Will-Stop-Us Award
  • Cambridge
    • Most Effective Approach
    • Best Master of Ceremonies
    • Marshall Cultural Exchange Award
    • Best Data & Data Visuals
    • Best Uniforms
  • Texas
    • Best Confession / Negative Control (One Year Late)
    • Best Live Demo, Again
    • Best Model-Driven Design
    • Best Proposed Funding Mechanism
  • Penn State
    • Best Brick Award (BBa_S03271, MotB)
    • Best New Sport (Beijing 2008 or bust!)
    • Best Use of Metaphor
  • Berkeley
    • Red-Eye Award
    • XXXtreme Presentation
    • Best Conceptual Advance
    • Most Innovative Brick Award (BBa_J01002)
  • Davidson
    • Best Team Name (SynthAces)
    • Best Debuggers
    • Best Interface Logic
  • Harvard
    • Best Part Numbers
    • Most Organized Presentation
    • Best Technology Integration Award
    • Most Parts Award
    • Best TAATACGACTCACTATAGGGAGA Award
    • Best Use of Redundancy
  • UCSF
    • Coolest Part
    • Most Innovative Abuse of Expensive Laboratory Equipment
    • Best Device Award
    • Most Thoughtful Approach

Highlights (some of the things that worked)

  • Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch)
  • Texas - Working and improved bacterial photography and signal processing device (built from BioBricks)
  • Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet)
  • MIT - Iron-induced control of any BioBrick device
  • Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB)
  • Harvard - Write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires."
  • UCSF - Wanted biological temperature detector, got a programmable biological thermometer
Retrieved from "http://2006.igem.org/wiki/index.php/IGEM_2005_Awards"
Personal tools
Past/present/future years