IGEM 2005 Awards

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
 
(6 intermediate revisions not shown)
Line 1: Line 1:
-
The following awards were given out at the 2005 Jamboree
+
The following awards were given out at the 2005 Jamboree by the [[Awards Panel]]
*Princeton
*Princeton
**Best Plasmid Naming Scheme
**Best Plasmid Naming Scheme
Line 11: Line 11:
**Feynman's Teaching Award
**Feynman's Teaching Award
-
+ETH
+
*ETH
-
++Best Wiki Award
+
**Best Wiki Award
-
++Most Sensitive Super Model Award  
+
**Most Sensitive Super Model Award  
-
++Precision Engineering Award  
+
**Precision Engineering Award
 +
**George W. Bush Geography Award
-
+MIT
+
*MIT
-
++Most Modest Goal  
+
**Most Modest Goal  
-
++Least Transportable Visual Aid
+
**Least Transportable Visual Aid
-
++Best Analogy
+
**Best Analogy
-
++Second Most Parts Award
+
**Second Most Parts Award
 +
**IKEA Idea Award
-
+Caltech
+
*Caltech
-
++Best Use of Transmogrified Smiley Faces
+
**Best Use of Transmogrified Smiley Faces
-
++Best New Application Area
+
**Best New Application Area
-
++Best New New Foundational Research Area
+
**Best New New Foundational Research Area
-
++Chuck D.'s Choice Award
+
**Chuck D.'s Choice Award
-
+Toronto  
+
*Toronto  
-
++Best Project Name (Cell-See-Us)
+
**Best Project Name (Cell-See-Us)
-
++Most Direct Use of Logic  
+
**Most Direct Use of Logic  
-
++Best Advice  
+
**Best Advice  
-
++Nothing-Will-Stop-Us Award
+
**Nothing-Will-Stop-Us Award
-
+Cambridge
+
*Cambridge
-
++Most Effective Approach
+
**Most Effective Approach
-
++Best Master of Ceremonies
+
**Best Master of Ceremonies
-
++Marshall Cultural Exchange Award  
+
**Marshall Cultural Exchange Award  
-
++Best Data & Data Visuals
+
**Best Data & Data Visuals
-
++Best Uniforms
+
**Best Uniforms
-
+Texas
+
*Texas
-
++Best Confession / Negative Control (One Year Late)
+
**Best Confession / Negative Control (One Year Late)
-
++Best Live Demo, Again
+
**Best Live Demo, Again
-
++Best Model-Driven Design
+
**Best Model-Driven Design
-
++Best Proposed Funding Mechanism
+
**Best Proposed Funding Mechanism
-
+Penn State  
+
*Penn State  
-
++Best Brick Award (BBa_S03271, MotB)
+
**Best Brick Award (BBa_S03271, MotB)
-
++Best New Sport (Beijing 2008 or bust!)
+
**Best New Sport (Beijing 2008 or bust!)
-
++Best Use of Metaphor
+
**Best Use of Metaphor
-
+Berkeley  
+
*Berkeley  
-
++Red-Eye Award
+
**Red-Eye Award
-
++XXXtreme Presentation  
+
**XXXtreme Presentation  
-
++Best Conceptual Advance
+
**Best Conceptual Advance
-
++Most Innovative Brick Award (BBa_J01002)
+
**Most Innovative Brick Award (BBa_J01002)
-
+Davidson  
+
*Davidson  
-
++Best Team Name (SynthAces)
+
**Best Team Name (SynthAces)
-
++Best Debuggers  
+
**Best Debuggers  
-
++Best Interface Logic  
+
**Best Interface Logic  
-
+Harvard  
+
*Harvard  
-
++Best Part Numbers  
+
**Best Part Numbers  
-
++Most Organized Presentation  
+
**Most Organized Presentation  
-
++Best Technology Integration Award
+
**Best Technology Integration Award
-
++Most Parts Award
+
**Most Parts Award
-
++Best TAATACGACTCACTATAGGGAGA Award
+
**Best TAATACGACTCACTATAGGGAGA Award
-
++Best Use of Redundancy  
+
**Best Use of Redundancy  
-
+UCSF  
+
*UCSF  
-
++Coolest Part
+
**Coolest Part
-
++Most Innovative Abuse of Expensive Laboratory Equipment
+
**Most Innovative Abuse of Expensive Laboratory Equipment
-
++Best Device Award  
+
**Best Device Award  
-
++Most Thoughtful Approach  
+
**Most Thoughtful Approach  
==Highlights (some of the things that worked)==
==Highlights (some of the things that worked)==
-
+Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch)
+
*Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch)
-
+Texas - Working and improved bacterial photography and signal processing device (built from BioBricks)
+
*Texas - Working and improved bacterial photography and signal processing device (built from BioBricks)
-
+Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet)
+
*Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet)
-
+MIT - Iron-induced control of any BioBrick device
+
*MIT - Iron-induced control of any BioBrick device
-
+Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB)
+
*Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB)
-
+Harvard - write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires."
+
*Harvard - Write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires."
-
+UCSF - wanted biological temperature detector, got a programmable biological thermometer
+
*UCSF - Wanted biological temperature detector, got a programmable biological thermometer

Latest revision as of 12:03, 24 November 2005

The following awards were given out at the 2005 Jamboree by the Awards Panel

  • Princeton
    • Best Plasmid Naming Scheme
    • Best "Show Must Go On" Moment
    • Best Honest Answer
    • Best Simulation of a Simulation
  • Oklahoma
    • Best "Hail Mary" Cloning
    • Best "Quantitative" Answer
    • Feynman's Teaching Award
  • ETH
    • Best Wiki Award
    • Most Sensitive Super Model Award
    • Precision Engineering Award
    • George W. Bush Geography Award
  • MIT
    • Most Modest Goal
    • Least Transportable Visual Aid
    • Best Analogy
    • Second Most Parts Award
    • IKEA Idea Award
  • Caltech
    • Best Use of Transmogrified Smiley Faces
    • Best New Application Area
    • Best New New Foundational Research Area
    • Chuck D.'s Choice Award
  • Toronto
    • Best Project Name (Cell-See-Us)
    • Most Direct Use of Logic
    • Best Advice
    • Nothing-Will-Stop-Us Award
  • Cambridge
    • Most Effective Approach
    • Best Master of Ceremonies
    • Marshall Cultural Exchange Award
    • Best Data & Data Visuals
    • Best Uniforms
  • Texas
    • Best Confession / Negative Control (One Year Late)
    • Best Live Demo, Again
    • Best Model-Driven Design
    • Best Proposed Funding Mechanism
  • Penn State
    • Best Brick Award (BBa_S03271, MotB)
    • Best New Sport (Beijing 2008 or bust!)
    • Best Use of Metaphor
  • Berkeley
    • Red-Eye Award
    • XXXtreme Presentation
    • Best Conceptual Advance
    • Most Innovative Brick Award (BBa_J01002)
  • Davidson
    • Best Team Name (SynthAces)
    • Best Debuggers
    • Best Interface Logic
  • Harvard
    • Best Part Numbers
    • Most Organized Presentation
    • Best Technology Integration Award
    • Most Parts Award
    • Best TAATACGACTCACTATAGGGAGA Award
    • Best Use of Redundancy
  • UCSF
    • Coolest Part
    • Most Innovative Abuse of Expensive Laboratory Equipment
    • Best Device Award
    • Most Thoughtful Approach

Highlights (some of the things that worked)

  • Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch)
  • Texas - Working and improved bacterial photography and signal processing device (built from BioBricks)
  • Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet)
  • MIT - Iron-induced control of any BioBrick device
  • Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB)
  • Harvard - Write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires."
  • UCSF - Wanted biological temperature detector, got a programmable biological thermometer
Personal tools
Past/present/future years