MIT teach the teachers summary 2006
From 2006.igem.org
MIT Teacher's Workshop, May 6th, 2006
Presentations and other information will be summarized here
Attendance: approx. 50 instructors
Introduction - Randy Rettberg Welcome comments, introduction to iGEM, comments on growth of program
Foundations of Synthetic Biology - Drew Endy slideshow video
DNA as technology Examples: Folding DNA Biological materiels science Growing houses Reprogramming bacteria: 100 person years to do the work GreenFuel: algal scrubbing of powerplant emissions Controlled invastion of cancer cells (voight) Resurrection of 1918 influenza Composite genomes and other full genome engineering Re-engineered E. coli Elowitz, ring oscillator
All of this is in the front line biology literature. This is still experimental - unlike other engineering disciplines. Hard work, long time. An electrical engineer can make a ring oscillator in 5 minutes. How can we make biology faster and easier?
Struggle, limited success, struggle. How can we get beyond the research project? This is where the abstraction hierarchy is important. Parts > Devices > Systems The Texas group created BioFilm with one new part and several pre-existing ones.
Classical Biotechnolgy founded on:
- Recombinant DNA
- Polymerase Chain Reaction
- Sequencing
Synthetic biology brings 3 more technologies
- Synthesis of DNA
- Standardization
- Abstraction
These technologies will be at least as important.
DNA synthesizers take information and translate into physical DNA (genetic information to genetic material). DNA synthesis still has a long way to go, but it's getting better quickly. Carlson curve shows this growth.
The complexity of creating DNA, once a long process, becomes: Get me this DNA. This creates a new problem: figuring out what we want.
Standards: important because it will determine how we interoperate. They are not boring. They make things easier to do. This is exciting! Example of standardization (1864) - argument for the standardization of screw threads.
There are all sorts of standards challenges in biology. Lots of work!
Physical composition. We need standards for the assembly of DNA, because we don't want to worry about assembly. We want the end product! The registry of standard parts was created so that students could share parts. The synthesis budget wasn't sufficient to cover all de novo synthesis.
Example of Datasheet (Bba_F2620). High water mark of current part standardization. Good, but we need better standards. NEB catalog also has good parts listing. The registry is an open source catalog.
Functional composition is also something that needs standards. Something as simple as promoter>rbs>coding does not work reliably. We need to see the failures! The failures are important, to understand why the failure occurred. This might allow the incorporation of, for example, a header sequence that might allow for more reliability.
Abstraction: we would like to make a technology that makes biology to interact with. Function in biology is organized across levels, to prevent being overwhelmed by information.
DNA > genetic material > taatacgactcactatagggacga (consensus promoter sequence for T7 RNA polymerase. Hard to remember and understand. Analogy is trying to program a computer by pushing 0's and 1's around with a toothpick.
Next level: Make it a part object - eg. R0083. Describe additional functional details. This is blackboxing.
Next level: Assemble parts to make higher level parts, or Devices (one or more parts with a human-defined function, eg. an inverter)
Next level is Systems - one or more devices that provide a human-defined function.
By coupling the systems using the rate of gene expression, a common signal carrier is used to link the devices together.
Barriers can be used to isolate information in the various layers. There is no need for a systems designer to know anything about the parts that make up devices, or the DNA code that underlies the parts.
Teaching Challenges:
The idea of standard parts in biology is very new. Even most scientists aren't sure about this yet. We're still in the "stone age". The materials used in construction are derived from nature, but heavily processed to produce more powerful substrates.
What is the most important attribute of a standard biological part? Lots of ideas - functionality, composibility, etc. Drew argues: that all the information is available so that the designer of the part need not be consulted.
Made a comic strip! Nice propaganda, but ultimately a failure. It hasn't worked so well for students.
In the end, the three technologies aiding synthetics are working to make it easier to engineer biological systems.
References
Synthetic Society - Drew Endy slides video
