Primers for Hin gene with LVA degredation tag

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
 
Line 1: Line 1:
-
'''''Hin gene with LVA degredation tag'''''
+
'''''Hin gene with LVA degredation tag Part BBa_J31001[http://partsregistry.org/Part:BBa_J31001]'''''
Will have the following primers synthesized so that the Hin gene has a LVA degredation tag.  PCR using these primers should take place after the Mutant Hin has already been transformed.
Will have the following primers synthesized so that the Hin gene has a LVA degredation tag.  PCR using these primers should take place after the Mutant Hin has already been transformed.

Latest revision as of 15:19, 31 July 2006

Hin gene with LVA degredation tag Part BBa_J31001[http://partsregistry.org/Part:BBa_J31001]

Will have the following primers synthesized so that the Hin gene has a LVA degredation tag. PCR using these primers should take place after the Mutant Hin has already been transformed.

Forward Primer

  • Consists of four base pairs from plasmid pSB1A2 [http://partsregistry.org/Part:pSB1A2]BioBrick prefix, and the first three base pairs of the Hin gene[http://partsregistry.org/Part:pSB1A2]

5'-->3'

TCTGGAATTCGCGGCCGCATCTAGAGATG

Reverse Primer

  • Consists of the Bio Brick suffix, Stop codon, LVA tag and the ,last 20 base pairs of the Hin gene (without the stop codon)

5'-->3'

CTGCAGGCGGCCGCTACTAGTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC

Retrieved from "http://2006.igem.org/wiki/index.php/Primers_for_Hin_gene_with_LVA_degredation_tag"
Personal tools
Past/present/future years