Primers for Hin gene with LVA degredation tag

From 2006.igem.org

Hin gene with LVA degredation tag

Will have the following primers synthesized so that the Hin gene has a LVA degredation tag. PCR using these primers should take place after the Mutant Hin has already been transformed.

Forward Primer

• Consists of a BioBrick prefix, four base pairs from plasmid pSB1A2 [1], and the first three base pairs of the Hin gene[2]

TCTGGAATTCGCGGCCGCATCTAGAGATG

Reverse Primer

• Consists of the Bio Brick suffix, Stop codon, LVA tag and the ,last 20 base pairs of the Hin gene (without the stop codon)

CTGCAGGCGGCCGCTACTAGTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC