Primers for Hin gene with LVA degredation tag
From 2006.igem.org
Revision as of 18:37, 12 June 2006 by Fizzle6821 (Talk | contribs)
Hin gene with LVA degredation tag
Will have the following primers synthesized so that the Hin gene has a LVA degredation tag. PCR using these primers should take place after the Mutant Hin has already been transformed.
Forward Primer
- Consists of four base pairs from plasmid pSB1A2 [http://partsregistry.org/Part:pSB1A2]BioBrick prefix, and the first three base pairs of the Hin gene[http://partsregistry.org/Part:pSB1A2]
TCTGGAATTCGCGGCCGCATCTAGAGATG
Reverse Primer
- Consists of the Bio Brick suffix, Stop codon, LVA tag and the ,last 20 base pairs of the Hin gene (without the stop codon)
CTGCAGGCGGCCGCTACTAGTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC