IGEM 2005 Awards

The following awards were given out at the 2005 Jamboree
*Princeton
**Best Plasmid Naming Scheme
**Best "Show Must Go On" Moment 
**Best Honest Answer 
**Best Simulation of a Simulation

*Oklahoma
**Best "Hail Mary" Cloning
**Best "Quantitative" Answer 
**Feynman's Teaching Award

*ETH
**Best Wiki Award
**Most Sensitive Super Model Award 
**Precision Engineering Award 

*MIT
**Most Modest Goal 
**Least Transportable Visual Aid
**Best Analogy
**Second Most Parts Award

*Caltech
**Best Use of Transmogrified Smiley Faces
**Best New Application Area
**Best New New Foundational Research Area
**Chuck D.'s Choice Award

*Toronto 
**Best Project Name (Cell-See-Us)
**Most Direct Use of Logic 
**Best Advice 
**Nothing-Will-Stop-Us Award

*Cambridge
**Most Effective Approach
**Best Master of Ceremonies
**Marshall Cultural Exchange Award 
**Best Data & Data Visuals
**Best Uniforms

*Texas
**Best Confession / Negative Control (One Year Late)
**Best Live Demo, Again
**Best Model-Driven Design
**Best Proposed Funding Mechanism

*Penn State 
**Best Brick Award (BBa_S03271, MotB)
**Best New Sport (Beijing 2008 or bust!)
**Best Use of Metaphor

*Berkeley 
**Red-Eye Award
**XXXtreme Presentation 
**Best Conceptual Advance
**Most Innovative Brick Award (BBa_J01002)

*Davidson 
**Best Team Name (SynthAces)
**Best Debuggers 
**Best Interface Logic 

*Harvard 
**Best Part Numbers 
**Most Organized Presentation 
**Best Technology Integration Award
**Most Parts Award
**Best TAATACGACTCACTATAGGGAGA Award
**Best Use of Redundancy 

*UCSF 
**Coolest Part
**Most Innovative Abuse of Expensive Laboratory Equipment
**Best Device Award 
**Most Thoughtful Approach 

==Highlights (some of the things that worked)==
*Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch)
*Texas - Working and improved bacterial photography and signal processing device (built from BioBricks)
*Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet)
*MIT - Iron-induced control of any BioBrick device
*Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB)
*Harvard - Write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires."
*UCSF - Wanted biological temperature detector, got a programmable biological thermometer