Hin gene: Part BBa J31000

From 2006.igem.org

You do not have permission to edit this page, for the following reason:

You can view and copy the source of this page:

'''''Hin gene: Part BBa_J31000'''''[http://partsregistry.org/Part:BBa_J31000] Primers for Hin gene * The 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in <font color='red'>red</font color>. '''Forward primer''' '''<font face="courier new">5’ GCATTCTAGAATGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGATTTACAGCGTAATGCGCTTAC<font color='red'>C</font color>AGTGCAAATTG 3’</font face>''' '''Reverse primer''' '''<font face="courier new">5’ ATGCCTGCAGGCGGCCGCACTAGTTTAATTCATTCGTTTTTTTATAC 3’</font face>'''

Return to Hin gene: Part BBa J31000.