Davidson Parts

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
 
(11 intermediate revisions not shown)
Line 1: Line 1:
-
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site.
+
[[Hin gene: Part BBa_J31000]]
 +
* Used Hin 100-1
-
Forward primer
+
[[Primers for Hin gene with LVA degredation tag]]
-
5’ gcattctagaatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttacCagtgcaaattg 3’
+
*Used HinLVA-2
-
Reverse primer
+
[[Recombinational Enahancer: Part BBa_J3101]]
-
5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac  3’
+
* used RE-11
 +
 
 +
[[HixC]]
 +
*Used Hix C-2
 +
 
 +
[[Resistance Genes]]
 +
*Tet Back- used TB1
 +
 
 +
[[Construction Intermediates]]

Latest revision as of 16:11, 31 July 2006

Hin gene: Part BBa_J31000

  • Used Hin 100-1

Primers for Hin gene with LVA degredation tag

  • Used HinLVA-2

Recombinational Enahancer: Part BBa_J3101

  • used RE-11

HixC

  • Used Hix C-2

Resistance Genes

  • Tet Back- used TB1

Construction Intermediates

Personal tools
Past/present/future years