Davidson Parts

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
 
(9 intermediate revisions not shown)
Line 1: Line 1:
-
'''''Hin gene'''''
+
[[Hin gene: Part BBa_J31000]]
 +
* Used Hin 100-1
-
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in '''bold'''.
+
[[Primers for Hin gene with LVA degredation tag]]
 +
*Used HinLVA-2
-
'''Forward primer'''
+
[[Recombinational Enahancer: Part BBa_J3101]]
 +
* used RE-11
-
5’ gcattctagaatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttac'''C'''agtgcaaattg 3’
+
[[HixC]]
 +
*Used Hix C-2
-
'''Reverse primer'''
+
[[Resistance Genes]]
 +
*Tet Back- used TB1
-
5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac  3’
+
[[Construction Intermediates]]
-
 
+
-
 
+
-
'''''Recombinational Enhancer'''''
+
-
 
+
-
These are the oligos that we ordered to make the recombinational enhancer.
+
-
 
+
-
AATTCGCGGCCGCTTCTAGATTCGGGTGTCAACAATTGACCAAAATAT
+
-
 
+
-
CGATTTACAGCGTAATGCGCTTTCTAGTGCAAATTGTGACCGC
+
-
 
+
-
ATTTTACTAGTTGCGGCCGCCTGCA
+
-
 
+
-
GGCGGCCGCAACTAGTAAAATGCGGTCACAATTTGCACTAGAA
+
-
 
+
-
AGCGCATTACGCTGTAAATCGATATTTTGGTCAATTGTTGACACCCGAATCTAGAAGCGGCCGCG
+

Latest revision as of 16:11, 31 July 2006

Hin gene: Part BBa_J31000

  • Used Hin 100-1

Primers for Hin gene with LVA degredation tag

  • Used HinLVA-2

Recombinational Enahancer: Part BBa_J3101

  • used RE-11

HixC

  • Used Hix C-2

Resistance Genes

  • Tet Back- used TB1

Construction Intermediates

Personal tools
Past/present/future years