Davidson Parts

From 2006.igem.org

Revision as of 18:31, 12 June 2006 (view source) Fizzle6821 (Talk | contribs) ← Older edit		Latest revision as of 16:11, 31 July 2006 (view source) Fizzle6821 (Talk | contribs)
(5 intermediate revisions not shown)
Line 1:		Line 1:
-	'''''Hin gene: Part BBa_J31000'''''	+	[[Hin gene: Part BBa_J31000]]
		+	* Used Hin 100-1
-	Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in '''bold'''.	+	[[Primers for Hin gene with LVA degredation tag]]
		+	*Used HinLVA-2
-	'''Forward primer'''	+	[[Recombinational Enahancer: Part BBa_J3101]]
		+	* used RE-11
-	5’ gcattctagaatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttac'''C'''agtgcaaattg 3’	+	[[HixC]]
		+	*Used Hix C-2
-	'''Reverse primer'''	+	[[Resistance Genes]]
		+	*Tet Back- used TB1
-	5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac  3’	+	[[Construction Intermediates]]
-		+
-	[[Primers for Hin gene with LVA degredation tag]]	+
-		+
-	[[Recombinational Enahancer: Part BBa_J3101]]	+

---

Latest revision as of 16:11, 31 July 2006

Hin gene: Part BBa_J31000

• Used Hin 100-1

Primers for Hin gene with LVA degredation tag

• Used HinLVA-2

Recombinational Enahancer: Part BBa_J3101

• used RE-11

HixC

• Used Hix C-2

Resistance Genes

• Tet Back- used TB1

Construction Intermediates