Davidson Parts

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
'''''Hin gene: Part BBa_J31000'''''
+
[[Hin gene: Part BBa_J31000}
-
 
+
-
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in '''bold'''.
+
-
 
+
-
'''Forward primer'''
+
-
 
+
-
5’ gcattctagaatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttac'''C'''agtgcaaattg 3’
+
-
 
+
-
'''Reverse primer'''
+
-
 
+
-
5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac  3’
+
[[Primers for Hin gene with LVA degredation tag]]
[[Primers for Hin gene with LVA degredation tag]]
[[Recombinational Enahancer: Part BBa_J3101]]
[[Recombinational Enahancer: Part BBa_J3101]]

Revision as of 18:33, 12 June 2006

[[Hin gene: Part BBa_J31000}

Primers for Hin gene with LVA degredation tag

Recombinational Enahancer: Part BBa_J3101

Retrieved from "http://2006.igem.org/wiki/index.php/Davidson_Parts"
Personal tools
Past/present/future years