Hin gene: Part BBa J31000

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
'''''Hin gene: Part BBa_J31000'''''[http://partsregistry.org/Part:BBa_J31000]
'''''Hin gene: Part BBa_J31000'''''[http://partsregistry.org/Part:BBa_J31000]
-
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in,<font color='red'>blue</font color>.
+
Primers for Hin gene
 +
* The 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in <font color='red'>red</font color>.
'''Forward primer'''
'''Forward primer'''

Revision as of 18:54, 12 June 2006

Hin gene: Part BBa_J31000[http://partsregistry.org/Part:BBa_J31000]

Primers for Hin gene

  • The 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in red.

Forward primer

5’ GCATTCTAGAATGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGATTTACAGCGTAATGCGCTTACCAGTGCAAATTG 3’

Reverse primer

5’ ATGCCTGCAGGCGGCCGCACTAGTTTAATTCATTCGTTTTTTTATAC 3’

Personal tools
Past/present/future years