Hin gene: Part BBa J31000

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
 
Line 10: Line 10:
'''Reverse primer'''
'''Reverse primer'''
 +
*Consists of <font color=green> four extra base pairs</font color>,<font color=red> Bio Brick</font color>, <font color=orange> the last 23 base pairs of the Hin gene</font color>
-
'''<font face="courier new">5’ ATGCCTGCAGGCGGCCGCACTAGTTTAATTCATTCGTTTTTTTATAC 3’</font face>'''
+
'''<font face="courier new">5’<font color=green> ATGC</font color><font color=red>CTGCAGGCGGCCGCACTAGT</font color><font color=orange>TTAATTCATTCGTTTTTTTATAC</font color> 3’</font face>'''

Latest revision as of 21:04, 12 June 2006

Hin gene: Part BBa_J31000[http://partsregistry.org/Part:BBa_J31000]

Primers for Hin gene

  • The 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in pink.

Forward primer

  • Consists of four extra base pairs, XBA restriction site, and the first 85 base pairs of the [http://partsregistry.org/Part:BBa_J31000| Hin gene]

5’ GCATTCTAGAATGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGATTTACAGCGTAATGCGCTTACCAGTGCAAATTG 3’

Reverse primer

  • Consists of four extra base pairs, Bio Brick, the last 23 base pairs of the Hin gene

5’ ATGCCTGCAGGCGGCCGCACTAGTTTAATTCATTCGTTTTTTTATAC 3’

Personal tools
Past/present/future years