Hin gene: Part BBa J31000
From 2006.igem.org
(Difference between revisions)
Fizzle6821 (Talk | contribs) |
Fizzle6821 (Talk | contribs) |
||
Line 10: | Line 10: | ||
'''Reverse primer''' | '''Reverse primer''' | ||
+ | *Consists of <font color=green> four extra base pairs</font color>,<font color=red> Bio Brick</font color>, <font color=orange> the last 23 base pairs of the Hin gene</font color> | ||
- | '''<font face="courier new">5’ | + | '''<font face="courier new">5’<font color=green> ATGC</font color><font color=red>CTGCAGGCGGCCGCACTAGT</font color><font color=orange>TTAATTCATTCGTTTTTTTATAC</font color> 3’</font face>''' |
Latest revision as of 21:04, 12 June 2006
Hin gene: Part BBa_J31000[http://partsregistry.org/Part:BBa_J31000]
Primers for Hin gene
- The 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in pink.
Forward primer
- Consists of four extra base pairs, XBA restriction site, and the first 85 base pairs of the [http://partsregistry.org/Part:BBa_J31000| Hin gene]
5’ GCATTCTAGAATGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGATTTACAGCGTAATGCGCTTACCAGTGCAAATTG 3’
Reverse primer
- Consists of four extra base pairs, Bio Brick, the last 23 base pairs of the Hin gene
5’ ATGCCTGCAGGCGGCCGCACTAGTTTAATTCATTCGTTTTTTTATAC 3’