Biobricks

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
(→Biobricks Taken From Registry)
 
(6 intermediate revisions not shown)
Line 4: Line 4:
{| border="1"
{| border="1"
|-
|-
-
| '''Parts''' || '''Function''' || '''Status'''
+
| '''Parts''' || '''Part No.''' || '''Function''' || '''Status'''
|-
|-
-
| E. coli ArsR to LacZ || pH lowering output in response to raised arsenate concentration || Not Working
+
| E. coli ArsR to LacZ || J33203 || pH lowering output in response to raised arsenate concentration || Working
|-  
|-  
-
| B. subtilis ArsR to LacZ || As Above || Doing again with correct lacZ
+
| B. subtilis ArsR to LacZ || J33206 || As Above || Background activity too high
|-
|-
-
| B. subtilis ArsR to lambda cI repressor || To repress the hybrid promoter in response to lower levels of arsenate || Done but untested
+
| B. subtilis ArsR to lambda cI repressor || n/a|| To repress the hybrid promoter in response to lower levels of arsenate || Done but untested
|-
|-
-
| GFP to Terminator || Testing ArsR function if can't get pH response || Done but not ligated to either ArsR
+
| GFP to Terminator || n/a || Testing ArsR function if can't get pH response || Done but not ligated to either ArsR
|-
|-
|}
|}
Line 19: Line 19:
{| border="1"
{| border="1"
|-
|-
-
| '''Biobrick''' || '''Construction''' || '''Ligations''' || '''Testing''' || '''Sequencing''' || '''Use'''
+
| '''Biobrick''' || '''Part No.''' || '''Construction''' || '''Ligations''' || '''Testing''' || '''Sequencing''' || '''Use'''
|-
|-
-
| E. coli ArsR || Complete || To LacZ || Not Working || Not Yet || Detection of Arsenic
+
| E. coli ArsR || J33201 || Complete || To LacZ || Working || Done || Detection of Arsenic
|-
|-
-
| B. subtilis ArsR || Complete || To LacZ || Not Tested || Not Yet || Detection of Arsenic
+
| B. subtilis ArsR || n/a ||  Complete || To LacZ || Tests Underway || biobrick suffix not correct, not in biobrick form  || Detection of Arsenic
|-
|-
-
| LacZ || Complete || To ArsR and Terminator || Tests Underway || Not Yet || Lowering pH/Reporting
+
| LacZ' || J33202 || Complete || To ArsR and Terminator || Working || Done || Lowering pH/Reporting
|-
|-
-
| Bacillus Urease || Site specific mutagenesis required || To ligate to hybrid promoter || N/A || Not Yet || Raising pH
+
| Bacillus Urease || n/a || Site specific mutagenesis required to remove EcoRI and SpeI sites || To ligate to hybrid promoter || N/A || Not Yet || Raising pH
|-
|-
-
| lambda cI/lacI Promoter || Underway || To ligate to urease || N/A || Not yet || Repressed by lambda cI and lacI in absence of lactose
+
| lambda cI/lacI Promoter || J33205 ||  Complete || To ligate to urease || Planned || Done || Repressed by lambda cI and lacI in absence of lactose
|-  
|-  
|}
|}
 +
=== Parts constructed but not used ===
 +
{| border="1"
 +
|-
 +
| '''Biobrick''' || '''Part No.''' || '''Function''' ||
 +
|-
 +
| xylE from Psuedomonas putida || J33204 || Reporter converting catechol to yellow colour
 +
|-
 +
|}
 +
=== Biobricks Taken From Registry ===
=== Biobricks Taken From Registry ===
Line 59: Line 68:
(5’) <font color='red'> tactagtagcggccgctgcagcctt </font> (3’)
(5’) <font color='red'> tactagtagcggccgctgcagcctt </font> (3’)
 +
 +
=== Primers used in our procedures ===
 +
{| border="1"
 +
|-
 +
| '''Name''' || '''Sequence''' || '''Use''' || '''Worked?''' || '''Sites'''
 +
|-
 +
| Ecarsf1||cctttctagagccaactcaaaattcac ||''E. coli arsR ''for J33201|| yes || XbaI
 +
|-
 +
| Ecarsr1||aaggctgcagcggccgctactagtacccggataaaacacatc ||''E. coli arsR ''for J33201|| yes || SpeI, NotI, PstI
 +
|-
 +
| laczf1||cctttctagaggaggaaacagctatgacc ||''E. coli lacZ' ''for J33202|| yes || XbaI
 +
|-
 +
| laczr1||aaggctgcagcggccgctactagtatcactccagccagctttc ||''E. coli lacZ' ''for J33202|| yes || SpeI, NotI, PstI
 +
|-
 +
| laczf2||ggtctagagctcatgttatatcccg ||''E. coli lacZ' ''for J33207|| yes || XbaI, SacI
 +
|-
 +
| Bsarsf2||atgagctccgttgctgtagtagc ||''B. subtilis arsR '' for J33206|| yes || SacI
 +
|-
 +
| Bsarsr2||aaactagtttagcagcaatctccttc ||''B. subtilis arsR '' for J33206|| yes || SpeI
 +
|-
 +
| Ppxylef2||ctgagctcatgaactatgaagaggtg ||''P. putida xylE '' for J33204|| yes || SacI
 +
|-
 +
| Ppxyler2||taactagtaccggaccatcaggtc ||''P. putida xylE ''for J33204|| yes || SpeI
 +
|-
 +
| Bsuref1||gagagctccgcaaattcgtagtagc ||''B. subtilis ureABC ''|| yes || SacI
 +
|-
 +
| Bsurer1||ctggatccatgggttttgtgcaccg ||''B. subtilis ureABC ''|| yes || BamHI
 +
|-
 +
| JAlam2(f)||gtggagctccgttaaatctatcaccgc ||lambda PRM-PR region|| yes || SacI
 +
|-
 +
| JAlam1(r)||catctcgagattatcaccgccagagg ||lambda PRM-PR region|| yes || XhoI
 +
|-
 +
| JAlac2(f)||gttctcgagaattgtgagcggataac ||''lac'' cI binding site|| yes || XhoI
 +
|-
 +
| BBinsf1||attcgcggccgcttctag ||sequencing biobrick inserts|| yes || N/A
 +
|-
 +
| BBinsr1||tgcagcggccgctactag ||sequencing biobrick inserts|| yes || N/A
 +
|-
 +
| Bsure1r1||tcctctagagagaccgttttctgctctc ||mutating SpeI site in ''ureABC''|| yes || XbaI
 +
|-
 +
| Bsure2f1||aaaacggtctcactagtgg ||mutating SpeI site in ''ureABC''|| yes || SpeI
 +
|-
 +
| Bsure2r1||catctcgagcttgctcagctttctg ||mutating EcoRI site in ''ureABC''|| yes || XhoI
 +
|-
 +
| Bsure3f2||aagctcgagatgaagctgaactcggctttg ||mutating EcoRI site in ''ureABC''|| see notes || XhoI
 +
|-
 +
| Bsure3r2||tacactagttttgtgcaccgtttttag ||''ureABC''|| yes || SpeI
 +
|-
 +
|}
 +
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]
__NOTOC__
__NOTOC__

Latest revision as of 14:19, 29 October 2006

Construction So Far

Devices Created

Parts Part No. Function Status
E. coli ArsR to LacZ J33203 pH lowering output in response to raised arsenate concentration Working
B. subtilis ArsR to LacZ J33206 As Above Background activity too high
B. subtilis ArsR to lambda cI repressor n/a To repress the hybrid promoter in response to lower levels of arsenate Done but untested
GFP to Terminator n/a Testing ArsR function if can't get pH response Done but not ligated to either ArsR

Biobricks Constructed By Us

Biobrick Part No. Construction Ligations Testing Sequencing Use
E. coli ArsR J33201 Complete To LacZ Working Done Detection of Arsenic
B. subtilis ArsR n/a Complete To LacZ Tests Underway biobrick suffix not correct, not in biobrick form Detection of Arsenic
LacZ' J33202 Complete To ArsR and Terminator Working Done Lowering pH/Reporting
Bacillus Urease n/a Site specific mutagenesis required to remove EcoRI and SpeI sites To ligate to hybrid promoter N/A Not Yet Raising pH
lambda cI/lacI Promoter J33205 Complete To ligate to urease Planned Done Repressed by lambda cI and lacI in absence of lactose

Parts constructed but not used

Biobrick Part No. Function
xylE from Psuedomonas putida J33204 Reporter converting catechol to yellow colour


Biobricks Taken From Registry

Biobrick Number and Location Ligations Testing Use
Terminator BBa_B0015, 1I To LacZ, plasmid used as vector for most ligations N/A Terminating
RBS BBa_B0034, 3O To ArsR from E. coli N/A Ribosome binding site
lambda cI BBa_R0051, 9C Not yet Not yet Repressing hybrid promoter
GFP BBa_E0040, 5H To Terminator Not Yet Testing Promoters

Primers Etc.

All biobricks have to have the following:

Prefix

(5’) cctttctagag (3’)

Suffix

(5’) tactagtagcggccgctgcagcctt (3’)

Primers used in our procedures

Name Sequence Use Worked? Sites
Ecarsf1cctttctagagccaactcaaaattcac E. coli arsR for J33201 yes XbaI
Ecarsr1aaggctgcagcggccgctactagtacccggataaaacacatc E. coli arsR for J33201 yes SpeI, NotI, PstI
laczf1cctttctagaggaggaaacagctatgacc E. coli lacZ' for J33202 yes XbaI
laczr1aaggctgcagcggccgctactagtatcactccagccagctttc E. coli lacZ' for J33202 yes SpeI, NotI, PstI
laczf2ggtctagagctcatgttatatcccg E. coli lacZ' for J33207 yes XbaI, SacI
Bsarsf2atgagctccgttgctgtagtagc B. subtilis arsR for J33206 yes SacI
Bsarsr2aaactagtttagcagcaatctccttc B. subtilis arsR for J33206 yes SpeI
Ppxylef2ctgagctcatgaactatgaagaggtg P. putida xylE for J33204 yes SacI
Ppxyler2taactagtaccggaccatcaggtc P. putida xylE for J33204 yes SpeI
Bsuref1gagagctccgcaaattcgtagtagc B. subtilis ureABC yes SacI
Bsurer1ctggatccatgggttttgtgcaccg B. subtilis ureABC yes BamHI
JAlam2(f)gtggagctccgttaaatctatcaccgc lambda PRM-PR region yes SacI
JAlam1(r)catctcgagattatcaccgccagagg lambda PRM-PR region yes XhoI
JAlac2(f)gttctcgagaattgtgagcggataac lac cI binding site yes XhoI
BBinsf1attcgcggccgcttctag sequencing biobrick inserts yes N/A
BBinsr1tgcagcggccgctactag sequencing biobrick inserts yes N/A
Bsure1r1tcctctagagagaccgttttctgctctc mutating SpeI site in ureABC yes XbaI
Bsure2f1aaaacggtctcactagtgg mutating SpeI site in ureABC yes SpeI
Bsure2r1catctcgagcttgctcagctttctg mutating EcoRI site in ureABC yes XhoI
Bsure3f2aagctcgagatgaagctgaactcggctttg mutating EcoRI site in ureABC see notes XhoI
Bsure3r2tacactagttttgtgcaccgtttttag ureABC yes SpeI


[http://2006.igem.org/University_of_Edinburgh_2006 Main page]

Retrieved from "http://2006.igem.org/wiki/index.php/Biobricks"
Personal tools
Past/present/future years