Davidson Parts

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
 
(7 intermediate revisions not shown)
Line 1: Line 1:
-
'''''Hin gene: Part BBa_J31000'''''
+
[[Hin gene: Part BBa_J31000]]
 +
* Used Hin 100-1
-
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in '''bold'''.
+
[[Primers for Hin gene with LVA degredation tag]]
 +
*Used HinLVA-2
-
'''Forward primer'''
+
[[Recombinational Enahancer: Part BBa_J3101]]
 +
* used RE-11
-
5’ gcattctagaatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttac'''C'''agtgcaaattg 3’
+
[[HixC]]
 +
*Used Hix C-2
-
'''Reverse primer'''
+
[[Resistance Genes]]
 +
*Tet Back- used TB1
-
5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac  3’
+
[[Construction Intermediates]]
-
 
+
-
'''''Hin gene with LVA degredation tag'''''
+
-
 
+
-
Will have the following primers synthesized so that the Hin gene has a LVA degredation tag.
+
-
 
+
-
'''Forward Primer'''
+
-
*Consists of a <font color='green'>BioBrick prefix</font color>, <font color='blue'>four base pairs from plasmid pSB1A2 [http://partsregistry.org/Part:pSB1A2]</font color>, and<font color='orange'> the first three base pairs of the Hin gene</font color>
+
-
<font face="courier new"><font color='blue'>TCTG</font color><font color='green'>GAATTCGCGGCCGCATCTAGAG</font color><font color='orange'>ATG</font color></font face>
+
-
 
+
-
'''''Reverse Primer'''''
+
-
*Consists of the <font color='green'>Bio Brick suffix</font color>,<font color='red'> Stop codon</font color>, <font color='purple'>LVA tag</font color> and the ,<font color='orange'>last 20 base pairs of the Hin gene</font color> (without the stop codon)
+
-
 
+
-
<font face="courier new"><font color='green'>CTGCAGGCGGCCGCTACTAGT</font color><font color='red'>ATT</font color><font color='purple'>AAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGC</font color><font color='orange'>ATTCATTCGTTTTTTTATAC</font color></font face>
+
-
 
+
-
 
+
-
[Recombinational Enahancer: Part BBa_J3101]
+
-
'''''Recombinational Enhancer: Part BBa_J3101'''''
+
-
 
+
-
These are the oligos that we ordered to make the recombinational enhancer.
+
-
 
+
-
AATTCGCGGCCGCTTCTAGATTCGGGTGTCAACAATTGACCAAAATAT
+
-
 
+
-
CGATTTACAGCGTAATGCGCTTTCTAGTGCAAATTGTGACCGC
+
-
 
+
-
ATTTTACTAGTTGCGGCCGCCTGCA
+
-
 
+
-
GGCGGCCGCAACTAGTAAAATGCGGTCACAATTTGCACTAGAA
+
-
 
+
-
AGCGCATTACGCTGTAAATCGATATTTTGGTCAATTGTTGACACCCGAATCTAGAAGCGGCCGCG
+

Latest revision as of 16:11, 31 July 2006

Hin gene: Part BBa_J31000

  • Used Hin 100-1

Primers for Hin gene with LVA degredation tag

  • Used HinLVA-2

Recombinational Enahancer: Part BBa_J3101

  • used RE-11

HixC

  • Used Hix C-2

Resistance Genes

  • Tet Back- used TB1

Construction Intermediates

Personal tools
Past/present/future years