Hin gene: Part BBa J31000
From 2006.igem.org
(Difference between revisions)
Fizzle6821 (Talk | contribs) |
Fizzle6821 (Talk | contribs) |
||
| (6 intermediate revisions not shown) | |||
| Line 1: | Line 1: | ||
| - | '''''Hin gene: Part BBa_J31000''''' | + | '''''Hin gene: Part BBa_J31000'''''[http://partsregistry.org/Part:BBa_J31000] |
| - | Primers for Hin gene | + | Primers for Hin gene |
| + | * The 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in <font color='magenta'>pink</font color>. | ||
'''Forward primer''' | '''Forward primer''' | ||
| + | *<font color=green>Consists of four extra base pairs</font color>, <font color=red>XBA restriction site</font color>, <font color=blue> and the first 85 base pairs of the [http://partsregistry.org/Part:BBa_J31000| Hin gene]</font color> | ||
| - | 5’ | + | '''<font face="courier new">5’ <font color='green'>GCAT</font color><font color=red>TCTAGA</font color><font color=blue>ATGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGATTTACAGCGTAATGCGCTTAC<font color='magenta'>C</font color>AGTGCAAATTG</font color> 3’</font face>''' |
'''Reverse primer''' | '''Reverse primer''' | ||
| + | *Consists of <font color=green> four extra base pairs</font color>,<font color=red> Bio Brick</font color>, <font color=orange> the last 23 base pairs of the Hin gene</font color> | ||
| - | 5’ | + | '''<font face="courier new">5’<font color=green> ATGC</font color><font color=red>CTGCAGGCGGCCGCACTAGT</font color><font color=orange>TTAATTCATTCGTTTTTTTATAC</font color> 3’</font face>''' |
Latest revision as of 21:04, 12 June 2006
Hin gene: Part BBa_J31000[http://partsregistry.org/Part:BBa_J31000]
Primers for Hin gene
- The 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in pink.
Forward primer
- Consists of four extra base pairs, XBA restriction site, and the first 85 base pairs of the [http://partsregistry.org/Part:BBa_J31000| Hin gene]
5’ GCATTCTAGAATGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGATTTACAGCGTAATGCGCTTACCAGTGCAAATTG 3’
Reverse primer
- Consists of four extra base pairs, Bio Brick, the last 23 base pairs of the Hin gene
5’ ATGCCTGCAGGCGGCCGCACTAGTTTAATTCATTCGTTTTTTTATAC 3’
