Biobricks
From 2006.igem.org
(Difference between revisions)
| Line 16: | Line 16: | ||
''Front primer sequence with Biobrick prefix'' | ''Front primer sequence with Biobrick prefix'' | ||
| - | |||
(5’) <font color='red'> cctttctagag ccaactcaaaattcacac </font> (3’) | (5’) <font color='red'> cctttctagag ccaactcaaaattcacac </font> (3’) | ||
| Line 22: | Line 21: | ||
''Back primer sequence with Biobrick suffix'' | ''Back primer sequence with Biobrick suffix'' | ||
| - | |||
(5’) <font color='red'> tactagtagcggccgctgcagcctt catatgtgtttagc </font> (3’) | (5’) <font color='red'> tactagtagcggccgctgcagcctt catatgtgtttagc </font> (3’) | ||
| + | |||
=== LacZ with Ribosome Binding Site Biobrick === | === LacZ with Ribosome Binding Site Biobrick === | ||
| Line 30: | Line 29: | ||
''Front primer sequence with Biobrick prefix'' | ''Front primer sequence with Biobrick prefix'' | ||
| - | |||
(5’) <font color='red'> cctttctagag gaaacagctatgaccatg </font> (3’) | (5’) <font color='red'> cctttctagag gaaacagctatgaccatg </font> (3’) | ||
| Line 36: | Line 34: | ||
''Back primer sequence with Biobrick suffix'' | ''Back primer sequence with Biobrick suffix'' | ||
| - | |||
(5’) <font color='red'> tactagtagcggccgctgcagcctt gaggggacgacgacag </font> (3’) | (5’) <font color='red'> tactagtagcggccgctgcagcctt gaggggacgacgacag </font> (3’) | ||
Revision as of 14:57, 6 July 2006
All biobricks have to have the following:
Prefix
(5’) cctttctagag (3’)
Suffix
(5’) tactagtagcggccgctgcagcctt (3’)
ArsR with Ribosome Binding Site Biobrick
Front primer sequence with Biobrick prefix
(5’) cctttctagag ccaactcaaaattcacac (3’)
Back primer sequence with Biobrick suffix
(5’) tactagtagcggccgctgcagcctt catatgtgtttagc (3’)
LacZ with Ribosome Binding Site Biobrick
Front primer sequence with Biobrick prefix
(5’) cctttctagag gaaacagctatgaccatg (3’)
Back primer sequence with Biobrick suffix
(5’) tactagtagcggccgctgcagcctt gaggggacgacgacag (3’)
