Biobricks
From 2006.igem.org
(Difference between revisions)
| Line 62: | Line 62: | ||
[http://2006.igem.org/University_of_Edinburgh_2006 Main page] | [http://2006.igem.org/University_of_Edinburgh_2006 Main page] | ||
| + | __NOTOC__ | ||
Revision as of 14:15, 17 August 2006
Construction So Far
Biobricks Constructed By Us
| Biobrick | Construction | Ligations | Testing | Sequencing | Use |
| E. coli ArsR | Complete | To LacZ | Not Working | Not Yet | Detection of Arsenic |
| B. subtilis ArsR | Complete | To LacZ | Not Tested | Not Yet | Detection of Arsenic |
| LacZ | Complete | To ArsR and Terminator | Tests Underway | Not Yet | Lowering pH/Reporting |
| Bacillus Urease | Site specific mutagenesis required | To ligate to hybrid promoter | N/A | Not Yet | Raising pH |
| lambda cI/lacI Promoter | Underway | To ligate to urease | N/A | Not yet | Repressed by lambda cI and lacI in absence of lactose |
Primers Etc.
All biobricks have to have the following:
Prefix
(5’) cctttctagag (3’)
Suffix
(5’) tactagtagcggccgctgcagcctt (3’)
ArsR with Ribosome Binding Site Biobrick
Front primer sequence with Biobrick prefix
(5’) cctttctagag ccaactcaaaattcacac (3’)
Back primer sequence with Biobrick suffix
(5’) tactagtagcggccgctgcagcctt catatgtgtttagc (3’)
LacZ with Ribosome Binding Site Biobrick
Front primer sequence with Biobrick prefix
(5’) cctttctagag gaaacagctatgaccatg (3’)
Back primer sequence with Biobrick suffix
(5’) tactagtagcggccgctgcagcctt gaggggacgacgacag (3’)
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]
