Biobricks

(Difference between revisions)

Revision as of 13:35, 29 October 2006

Parts	Part No.	Function	Status
E. coli ArsR to LacZ	J33203	pH lowering output in response to raised arsenate concentration	Working
B. subtilis ArsR to LacZ	J33206	As Above	Background activity too high
B. subtilis ArsR to lambda cI repressor	n/a	To repress the hybrid promoter in response to lower levels of arsenate	Done but untested
GFP to Terminator	n/a	Testing ArsR function if can't get pH response	Done but not ligated to either ArsR

Biobrick	Part No.	Construction	Ligations	Testing	Sequencing	Use
E. coli ArsR	J33201	Complete	To LacZ	Working	Done	Detection of Arsenic
B. subtilis ArsR	n/a	Complete	To LacZ	Tests Underway	biobrick suffix not correct, not in biobrick form	Detection of Arsenic
LacZ'	J33202	Complete	To ArsR and Terminator	Working	Done	Lowering pH/Reporting
Bacillus Urease	n/a	Site specific mutagenesis required to remove EcoRI and SpeI sites	To ligate to hybrid promoter	N/A	Not Yet	Raising pH
lambda cI/lacI Promoter	J33205	Complete	To ligate to urease	Planned	Done	Repressed by lambda cI and lacI in absence of lactose

Biobrick	Part No.	Function
xylE from Psuedomonas putida	J33204	Reporter converting catechol to yellow colour

Biobrick	Number and Location	Ligations	Testing	Use
Terminator	BBa_B0015, 1I	To LacZ, plasmid used as vector for most ligations	N/A	Terminating
RBS	BBa_B0034, 3O	To ArsR from E. coli	N/A	Ribosome binding site
lambda cI	BBa_R0051, 9C	Not yet	Not yet	Repressing hybrid promoter
GFP	BBa_E0040, 5H	To Terminator	Not Yet	Testing Promoters

All biobricks have to have the following:

Prefix

(5’) cctttctagag (3’)

Suffix

(5’) tactagtagcggccgctgcagcctt (3’)

Name	Sequence	Use	Worked?	Sites
Ecarsf1	cctttctagagccaactcaaaattcac	E. coli arsR for J33201	yes	XbaI
Ecarsr1	aaggctgcagcggccgctactagtacccggataaaacacatc	E. coli arsR for J33201	yes	SpeI, NotI, PstI
laczf1	cctttctagaggaggaaacagctatgacc	E. coli lacZ' for J33202	yes	XbaI
laczr1	aaggctgcagcggccgctactagtatcactccagccagctttc	E. coli lacZ' for J33202	yes	SpeI, NotI, PstI
laczf2	ggtctagagctcatgttatatcccg	E. coli lacZ' for J33207	yes	XbaI, SacI
Bsarsf2	atgagctccgttgctgtagtagc	B. subtilis arsR for J33206	yes	SacI
Bsarsr2	aaactagtttagcagcaatctccttc	B. subtilis arsR for J33206	yes	SpeI
Ppxylef2	ctgagctcatgaactatgaagaggtg	P. putida xylE for J33204	yes	SacI
Ppxyler2	taactagtaccggaccatcaggtc	P. putida xylE for J33204	yes	SpeI
Bsuref1	gagagctccgcaaattcgtagtagc	B. subtilis ureABC	yes	SacI
Bsurer1	ctggatccatgggttttgtgcaccg	B. subtilis ureABC	yes	BamHI
JAlam2(f)	gtggagctccgttaaatctatcaccgc	lambda PRM-PR region	yes	SacI
JAlam1(r)	catctcgagattatcaccgccagagg	lambda PRM-PR region	yes	XhoI
JAlac2(f)	gttctcgagaattgtgagcggataac	lac cI binding site	yes	XhoI
BBinsf1	attcgcggccgcttctag	sequencing biobrick inserts	yes	N/A
BBinsr1	tgcagcggccgctactag	sequencing biobrick inserts	yes	N/A

[http://2006.igem.org/University_of_Edinburgh_2006 Main page]

@@ Line 91: / Line 91: @@
 |-
 | Ppxyler2||taactagtaccggaccatcaggtc ||''P. putida xylE ''for J33204|| yes || SpeI
+|-
+| Bsuref1||gagagctccgcaaattcgtagtagc ||''B. subtilis ureABC ''|| yes || SacI
+|-
+| Bsurer1||ctggatccatgggttttgtgcaccg ||''B. subtilis ureABC ''|| yes || BamHI
+|-
+| JAlam2(f)||gtggagctccgttaaatctatcaccgc ||lambda PRM-PR region|| yes || SacI
+|-
+| JAlam1(r)||catctcgagattatcaccgccagagg ||lambda PRM-PR region|| yes || XhoI
+|-
+| JAlac2(f)||gttctcgagaattgtgagcggataac ||''lac'' cI binding site|| yes || XhoI
+|-
+| BBinsf1||attcgcggccgcttctag ||sequencing biobrick inserts|| yes || N/A
+|-
+| BBinsr1||tgcagcggccgctactag ||sequencing biobrick inserts|| yes || N/A
 |-
 |}