Davidson Parts
From 2006.igem.org
(Difference between revisions)
Macampbell (Talk | contribs) |
|||
| Line 1: | Line 1: | ||
| - | '''''Hin gene''''' | + | '''''Hin gene: Part BBa_J31000''''' |
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in '''bold'''. | Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in '''bold'''. | ||
| Line 12: | Line 12: | ||
| - | '''''Recombinational Enhancer''''' | + | '''''Recombinational Enhancer: Part BBa_J3101''''' |
These are the oligos that we ordered to make the recombinational enhancer. | These are the oligos that we ordered to make the recombinational enhancer. | ||
Revision as of 18:47, 7 June 2006
Hin gene: Part BBa_J31000
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in bold.
Forward primer
5’ gcattctagaatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttacCagtgcaaattg 3’
Reverse primer
5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac 3’
Recombinational Enhancer: Part BBa_J3101
These are the oligos that we ordered to make the recombinational enhancer.
AATTCGCGGCCGCTTCTAGATTCGGGTGTCAACAATTGACCAAAATAT
CGATTTACAGCGTAATGCGCTTTCTAGTGCAAATTGTGACCGC
ATTTTACTAGTTGCGGCCGCCTGCA
GGCGGCCGCAACTAGTAAAATGCGGTCACAATTTGCACTAGAA
AGCGCATTACGCTGTAAATCGATATTTTGGTCAATTGTTGACACCCGAATCTAGAAGCGGCCGCG
