From 2006.igem.org
(Difference between revisions)
|
|
| Line 11: |
Line 11: |
| | 5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac 3’ | | 5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac 3’ |
| | | | |
| - | '''''Hin gene with LVA degredation tag'''''
| + | [[Primers for Hin gene with LVA degredation tag]] |
| - | | + | |
| - | Will have the following primers synthesized so that the Hin gene has a LVA degredation tag.
| + | |
| - | | + | |
| - | '''Forward Primer'''
| + | |
| - | *Consists of a <font color='green'>BioBrick prefix</font color>, <font color='blue'>four base pairs from plasmid pSB1A2 [http://partsregistry.org/Part:pSB1A2]</font color>, and<font color='orange'> the first three base pairs of the Hin gene</font color>
| + | |
| - | <font face="courier new"><font color='blue'>TCTG</font color><font color='green'>GAATTCGCGGCCGCATCTAGAG</font color><font color='orange'>ATG</font color></font face>
| + | |
| - | | + | |
| - | '''''Reverse Primer'''''
| + | |
| - | *Consists of the <font color='green'>Bio Brick suffix</font color>,<font color='red'> Stop codon</font color>, <font color='purple'>LVA tag</font color> and the ,<font color='orange'>last 20 base pairs of the Hin gene</font color> (without the stop codon)
| + | |
| - | | + | |
| - | <font face="courier new"><font color='green'>CTGCAGGCGGCCGCTACTAGT</font color><font color='red'>ATT</font color><font color='purple'>AAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGC</font color><font color='orange'>ATTCATTCGTTTTTTTATAC</font color></font face>
| + | |
| - | | + | |
| | | | |
| | [[Recombinational Enahancer: Part BBa_J3101]] | | [[Recombinational Enahancer: Part BBa_J3101]] |
| - |
| |
| - | '''''Recombinational Enhancer: Part BBa_J3101'''''
| |
| - |
| |
| - | These are the oligos that we ordered to make the recombinational enhancer.
| |
| - |
| |
| - | AATTCGCGGCCGCTTCTAGATTCGGGTGTCAACAATTGACCAAAATAT
| |
| - |
| |
| - | CGATTTACAGCGTAATGCGCTTTCTAGTGCAAATTGTGACCGC
| |
| - |
| |
| - | ATTTTACTAGTTGCGGCCGCCTGCA
| |
| - |
| |
| - | GGCGGCCGCAACTAGTAAAATGCGGTCACAATTTGCACTAGAA
| |
| - |
| |
| - | AGCGCATTACGCTGTAAATCGATATTTTGGTCAATTGTTGACACCCGAATCTAGAAGCGGCCGCG
| |
Revision as of 18:31, 12 June 2006
Hin gene: Part BBa_J31000
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in bold.
Forward primer
5’ gcattctagaatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttacCagtgcaaattg 3’
Reverse primer
5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac 3’
Primers for Hin gene with LVA degredation tag
Recombinational Enahancer: Part BBa_J3101
