Hin gene: Part BBa J31000
From 2006.igem.org
(Difference between revisions)
Fizzle6821 (Talk | contribs) |
Fizzle6821 (Talk | contribs) |
||
| Line 1: | Line 1: | ||
'''''Hin gene: Part BBa_J31000''''' | '''''Hin gene: Part BBa_J31000''''' | ||
| - | Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in ''' | + | Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in,<font color='blue'>'''blue'''</font color>. |
'''Forward primer''' | '''Forward primer''' | ||
| - | 5’ | + | <font face="courier new">5’ GCATTCTAGAATGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGATTTACAGCGTAATGCGCTTAC<font color='blue'>'''C'''</font color>AGTGCAAATTG 3’</font face> |
'''Reverse primer''' | '''Reverse primer''' | ||
| - | 5’ | + | <font face="courier new">5’ ATGCCTGCAGGCGGCCGCACTAGTTTAATTCATTCGTTTTTTTATAC 3’</font face> |
Revision as of 18:42, 12 June 2006
Hin gene: Part BBa_J31000
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in,blue.
Forward primer
5’ GCATTCTAGAATGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGATTTACAGCGTAATGCGCTTACCAGTGCAAATTG 3’
Reverse primer
5’ ATGCCTGCAGGCGGCCGCACTAGTTTAATTCATTCGTTTTTTTATAC 3’
