Hin gene: Part BBa J31000
From 2006.igem.org
(Difference between revisions)
Fizzle6821 (Talk | contribs) |
Fizzle6821 (Talk | contribs) |
||
Line 2: | Line 2: | ||
Primers for Hin gene | Primers for Hin gene | ||
- | * The 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in <font color=' | + | * The 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in <font color='magenta'>pink</font color>. |
'''Forward primer''' | '''Forward primer''' | ||
+ | *<font color=green>Consists of four extra base pairs</font color>, <font color=red>XBA restriction site</font color>, <font color=blue> and the first 85 base pairs of the [http://partsregistry.org/Part:BBa_J31000| Hin gene]</font color> | ||
- | '''<font face="courier new">5’ | + | '''<font face="courier new">5’ <font color='green'>GCAT</font color><font color=red>TCTAGA</font color><font color=blue>ATGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGATTTACAGCGTAATGCGCTTAC<font color='magenta'>C</font color>AGTGCAAATTG</font color> 3’</font face>''' |
'''Reverse primer''' | '''Reverse primer''' | ||
'''<font face="courier new">5’ ATGCCTGCAGGCGGCCGCACTAGTTTAATTCATTCGTTTTTTTATAC 3’</font face>''' | '''<font face="courier new">5’ ATGCCTGCAGGCGGCCGCACTAGTTTAATTCATTCGTTTTTTTATAC 3’</font face>''' |
Revision as of 20:53, 12 June 2006
Hin gene: Part BBa_J31000[http://partsregistry.org/Part:BBa_J31000]
Primers for Hin gene
- The 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in pink.
Forward primer
- Consists of four extra base pairs, XBA restriction site, and the first 85 base pairs of the [http://partsregistry.org/Part:BBa_J31000| Hin gene]
5’ GCATTCTAGAATGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGATTTACAGCGTAATGCGCTTACCAGTGCAAATTG 3’
Reverse primer
5’ ATGCCTGCAGGCGGCCGCACTAGTTTAATTCATTCGTTTTTTTATAC 3’