Biobricks

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
(c)
Line 1: Line 1:
All biobricks have to have the following:
All biobricks have to have the following:
-
:Prefix (5’) cctttctagag (3’)
+
''Prefix''              (5’) cctttctagag (3’)
-
:Suffix (5’) tactagtagcggccgctgcagcctt (3’)
+
''Suffix'' (5’) tactagtagcggccgctgcagcctt (3’)
=== ArsR with Ribosome Binding Site Biobrick ===
=== ArsR with Ribosome Binding Site Biobrick ===

Revision as of 14:54, 6 July 2006

All biobricks have to have the following:

Prefix (5’) cctttctagag (3’) Suffix (5’) tactagtagcggccgctgcagcctt (3’)

ArsR with Ribosome Binding Site Biobrick

Front primer sequence with Biobrick prefix


(5’) cctttctagag ccaactcaaaattcacac (3’)


Back primer sequence with Biobrick suffix


(5’) tactagtagcggccgctgcagcctt catatgtgtttagc (3’)

LacZ with Ribosome Binding Site Biobrick

Front primer sequence with Biobrick prefix


(5’) cctttctagag gaaacagctatgaccatg (3’)


Back primer sequence with Biobrick suffix


(5’) tactagtagcggccgctgcagcctt gaggggacgacgacag (3’)

Personal tools
Past/present/future years