Biobricks
From 2006.igem.org
(Difference between revisions)
(c) |
|||
| Line 1: | Line 1: | ||
All biobricks have to have the following: | All biobricks have to have the following: | ||
| - | ''Prefix'' (5’) cctttctagag (3’) | + | ''Prefix'' (5’) <font color='red'> cctttctagag </font> (3’) |
| - | ''Suffix'' (5’) tactagtagcggccgctgcagcctt (3’) | + | ''Suffix'' (5’) <font color='red'> tactagtagcggccgctgcagcctt </font> (3’) |
=== ArsR with Ribosome Binding Site Biobrick === | === ArsR with Ribosome Binding Site Biobrick === | ||
| Line 9: | Line 9: | ||
| - | (5’) cctttctagag ccaactcaaaattcacac (3’) | + | (5’) <font color='red'> cctttctagag ccaactcaaaattcacac </font> (3’) |
| Line 15: | Line 15: | ||
| - | (5’) tactagtagcggccgctgcagcctt catatgtgtttagc (3’) | + | (5’) <font color='red'> tactagtagcggccgctgcagcctt catatgtgtttagc </font> (3’) |
=== LacZ with Ribosome Binding Site Biobrick === | === LacZ with Ribosome Binding Site Biobrick === | ||
| Line 22: | Line 22: | ||
| - | (5’) cctttctagag gaaacagctatgaccatg (3’) | + | (5’) <font color='red'> cctttctagag gaaacagctatgaccatg </font> (3’) |
| Line 28: | Line 28: | ||
| - | (5’) tactagtagcggccgctgcagcctt gaggggacgacgacag (3’) | + | (5’) <font color='red'> tactagtagcggccgctgcagcctt gaggggacgacgacag </font> (3’) |
Revision as of 14:55, 6 July 2006
All biobricks have to have the following:
Prefix (5’) cctttctagag (3’) Suffix (5’) tactagtagcggccgctgcagcctt (3’)
ArsR with Ribosome Binding Site Biobrick
Front primer sequence with Biobrick prefix
(5’) cctttctagag ccaactcaaaattcacac (3’)
Back primer sequence with Biobrick suffix
(5’) tactagtagcggccgctgcagcctt catatgtgtttagc (3’)
LacZ with Ribosome Binding Site Biobrick
Front primer sequence with Biobrick prefix
(5’) cctttctagag gaaacagctatgaccatg (3’)
Back primer sequence with Biobrick suffix
(5’) tactagtagcggccgctgcagcctt gaggggacgacgacag (3’)
