Biobricks
From 2006.igem.org
(Difference between revisions)
Line 6: | Line 6: | ||
=== ArsR with Ribosome Binding Site Biobrick === | === ArsR with Ribosome Binding Site Biobrick === | ||
- | Front primer sequence with Biobrick prefix | + | ''Front primer sequence with Biobrick prefix'' |
Line 12: | Line 12: | ||
- | Back primer sequence with Biobrick suffix | + | ''Back primer sequence with Biobrick suffix'' |
Line 19: | Line 19: | ||
=== LacZ with Ribosome Binding Site Biobrick === | === LacZ with Ribosome Binding Site Biobrick === | ||
- | Front primer sequence with Biobrick prefix | + | ''Front primer sequence with Biobrick prefix'' |
Line 25: | Line 25: | ||
- | Back primer sequence with Biobrick suffix | + | ''Back primer sequence with Biobrick suffix'' |
(5’) <font color='red'> tactagtagcggccgctgcagcctt gaggggacgacgacag </font> (3’) | (5’) <font color='red'> tactagtagcggccgctgcagcctt gaggggacgacgacag </font> (3’) |
Revision as of 14:56, 6 July 2006
All biobricks have to have the following:
Prefix (5’) cctttctagag (3’) Suffix (5’) tactagtagcggccgctgcagcctt (3’)
ArsR with Ribosome Binding Site Biobrick
Front primer sequence with Biobrick prefix
(5’) cctttctagag ccaactcaaaattcacac (3’)
Back primer sequence with Biobrick suffix
(5’) tactagtagcggccgctgcagcctt catatgtgtttagc (3’)
LacZ with Ribosome Binding Site Biobrick
Front primer sequence with Biobrick prefix
(5’) cctttctagag gaaacagctatgaccatg (3’)
Back primer sequence with Biobrick suffix
(5’) tactagtagcggccgctgcagcctt gaggggacgacgacag (3’)