Biobricks
From 2006.igem.org
(Difference between revisions)
| Line 1: | Line 1: | ||
All biobricks have to have the following: | All biobricks have to have the following: | ||
| - | ''Prefix'' (5’) <font color='red'> cctttctagag </font> (3’) | + | ''Prefix'' |
| - | ''Suffix'' (5’) <font color='red'> tactagtagcggccgctgcagcctt </font> (3’) | + | |
| + | |||
| + | (5’) <font color='red'> cctttctagag </font> (3’) | ||
| + | |||
| + | |||
| + | ''Suffix'' | ||
| + | |||
| + | |||
| + | (5’) <font color='red'> tactagtagcggccgctgcagcctt </font> (3’) | ||
=== ArsR with Ribosome Binding Site Biobrick === | === ArsR with Ribosome Binding Site Biobrick === | ||
Revision as of 14:56, 6 July 2006
All biobricks have to have the following:
Prefix
(5’) cctttctagag (3’)
Suffix
(5’) tactagtagcggccgctgcagcctt (3’)
ArsR with Ribosome Binding Site Biobrick
Front primer sequence with Biobrick prefix
(5’) cctttctagag ccaactcaaaattcacac (3’)
Back primer sequence with Biobrick suffix
(5’) tactagtagcggccgctgcagcctt catatgtgtttagc (3’)
LacZ with Ribosome Binding Site Biobrick
Front primer sequence with Biobrick prefix
(5’) cctttctagag gaaacagctatgaccatg (3’)
Back primer sequence with Biobrick suffix
(5’) tactagtagcggccgctgcagcctt gaggggacgacgacag (3’)
