Biobricks
From 2006.igem.org
(Difference between revisions)
| Line 10: | Line 10: | ||
(5’) <font color='red'> tactagtagcggccgctgcagcctt </font> (3’) | (5’) <font color='red'> tactagtagcggccgctgcagcctt </font> (3’) | ||
| + | |||
| + | {| border="1" | ||
| + | |- | ||
| + | | Biobrick || Construction || Ligations || Testing || Sequencing || Use | ||
| + | |- | ||
| + | | E. coli ArsR || Complete || To LacZ || Not Working || Not Yet || Detection of Arsenic | ||
| + | |- | ||
| + | | B. subtilis || Complete || To LacZ || Not Tested || Not Yet || Detection of Arsenic | ||
| + | |} | ||
Revision as of 14:05, 17 August 2006
All biobricks have to have the following:
Prefix
(5’) cctttctagag (3’)
Suffix
(5’) tactagtagcggccgctgcagcctt (3’)
| Biobrick | Construction | Ligations | Testing | Sequencing | Use |
| E. coli ArsR | Complete | To LacZ | Not Working | Not Yet | Detection of Arsenic |
| B. subtilis | Complete | To LacZ | Not Tested | Not Yet | Detection of Arsenic |
ArsR with Ribosome Binding Site Biobrick
Front primer sequence with Biobrick prefix
(5’) cctttctagag ccaactcaaaattcacac (3’)
Back primer sequence with Biobrick suffix
(5’) tactagtagcggccgctgcagcctt catatgtgtttagc (3’)
LacZ with Ribosome Binding Site Biobrick
Front primer sequence with Biobrick prefix
(5’) cctttctagag gaaacagctatgaccatg (3’)
Back primer sequence with Biobrick suffix
(5’) tactagtagcggccgctgcagcctt gaggggacgacgacag (3’)
[http://2006.igem.org/University_of_Edinburgh_2006 Main page]
