Biobricks

From 2006.igem.org

Revision as of 14:15, 17 August 2006 (view source) Judenich (Talk | contribs) ← Older edit		Revision as of 14:15, 17 August 2006 (view source) Judenich (Talk | contribs) (→Biobricks Constructed By Us) Newer edit →
Line 1:		Line 1:
	== Construction So Far ==		== Construction So Far ==
-	= Biobricks Constructed By Us =	+	=== Biobricks Constructed By Us ===
	{| border="1"		{| border="1"
	|-		|-

---

Revision as of 14:15, 17 August 2006

Construction So Far

Biobricks Constructed By Us

Biobrick	Construction	Ligations	Testing	Sequencing	Use
E. coli ArsR	Complete	To LacZ	Not Working	Not Yet	Detection of Arsenic
B. subtilis ArsR	Complete	To LacZ	Not Tested	Not Yet	Detection of Arsenic
LacZ	Complete	To ArsR and Terminator	Tests Underway	Not Yet	Lowering pH/Reporting
Bacillus Urease	Site specific mutagenesis required	To ligate to hybrid promoter	N/A	Not Yet	Raising pH
lambda cI/lacI Promoter	Underway	To ligate to urease	N/A	Not yet	Repressed by lambda cI and lacI in absence of lactose

Primers Etc.

All biobricks have to have the following:

Prefix

(5’) cctttctagag (3’)

Suffix

(5’) tactagtagcggccgctgcagcctt (3’)

ArsR with Ribosome Binding Site Biobrick

Front primer sequence with Biobrick prefix

(5’) cctttctagag ccaactcaaaattcacac (3’)

Back primer sequence with Biobrick suffix

(5’) tactagtagcggccgctgcagcctt catatgtgtttagc (3’)

LacZ with Ribosome Binding Site Biobrick

Front primer sequence with Biobrick prefix

(5’) cctttctagag gaaacagctatgaccatg (3’)

Back primer sequence with Biobrick suffix

(5’) tactagtagcggccgctgcagcctt gaggggacgacgacag (3’)

[http://2006.igem.org/University_of_Edinburgh_2006 Main page]