Lab Work

From 2006.igem.org

Revision as of 10:17, 21 August 2006

18th August 2006

ArsR insert isolated from gel, and some ligated to the 3O ribosome binding site containing vector. Minipreps showed the ArsR and lacZ ligation successful and plated to go upstairs. Some of the lambda cI and arsR ligations were also successful, but failure to include a ribosome binding site probably means this construct will not work.

17th August 2006

Minipreps on the ArsR (not ligated) to make a stock. Overnight cultures set up of ArsR and lacZ ligated construct. We also did a test digestion on the urease construct, to see if the pattern corresponds with the position of the SpeI and EcoRI internal restriction sites, and a preparative digestion of the arsR from Bacillus subtilis to have ready for future ligation.

16th August 2006

Ligation of ArsR B. subtilis to lacZ and lambda cI, transformation of the ligated constructs to competant cells.

15th August 2006

Unfortunately, there were problems with the arsR plasmid (either too small a concentration or wrong enzymes used), and I was unable to get a band on a gel to use for ligations. A cut plasmid with the lacZ and terminator was prepared and frozen to (hopefully) do the ligations tomorrow.

14th August 2006

The lambda cI and terminator plasmid was cut with EcoRI and XbaI and run on a gel, and then extracted and put in the freezer for ligations tomorrow.

In addition, the arsR gene from Bacillus subtilis was obtained as a biobrick (thanks to Chris French) and tomorrow it will be ligated with the lacZ and lambda cI with terminator plasmids.

11th August 2006

Minipreps were done today, and the ligations and retransformations were all successful.

10th August 2006

Minipreps were prepared today from yesterday's transformations, and they will be done tomorrow.

9th August 2006

The ligation was done today, and retransformations of old stock DNA was started. These were plated.

In addition, experiments with the prepared arsenic constructs have revealed potential problems with the arsenic promoter sequence which will have to be checked. In addition, the '3U' lacZ gene apparently does not work at all, so the 4U one will be used from now on.

8th August 2006

The 5G plasmid was cut with EcoRI and XbaI,and the plasmid containing the terminator with EcoRI and SpeI in preparation for ligation. They were run on a gel and extracted, and then frozen for tomorrow.

More stuff to be done

• Urease

Once we've got the urease clone that Chris is working on, we need to see if it still works in the strain of bacteria that we're using. So we need to transfer the plasmid into our strain, then do some tests on it to see if it works.

If it does work, we need to mutate out the inappropriate sites. The protocol for doing this is online at http://www.stratagene.com/manuals/200518.pdf The primers for it will be ordered once we know that the urease works, and they are as follows:

For mutating out EcoRI:

cttcggcaaagccgagttcagcttcatatccag

ctggatatgaagctgaactcggctttgccgaag

For mutating out SpeI:

cctctgatttccactagagagaccgttttctgctc

gagcagaaaacggtctctctagtggaaatcagagg

Once we've done that, the urease is ready to be biobricked, and also ready to be assembled with our shiny new promoter (once the promoter is ready).

• LacI/Lambda cI promoter:

The primers for this have been designed and should be ordered today. They are as follows.

For the cI binding site: Primer 1: 5'- catctcgagattatcaccgccagagg -3' (has Xho1 site added on 5' end) Primer 2: 5'- gtggagctccgttaaatctatcaccgc - 3' (has Sac1 site added on 5' end) These should be used for a PCR reaction with the Lambda bacteriophage that Chris found.

For the lacI/lacZ: We should have a primer left over with the suffix added from the time we were biobricking LacZ. The other primer is 5' gttctcgagaattgtgagcggataac 3' (with XhoI site added on 5' end) These should be used for a PCR reaction with an E. coli cell.

Provided the PCR works, we'll end up with the following two chunks of DNA:

---SacI site---lambda cI binding site+promoter---XhoI site---

---XhoI site-LacI binding site---LacZ---SpeI site---

There is a new Biobrick vector Chris designed (named Edinbrick I :) ), with a SacI site added after the prefix, which is the vector we'll be using for this reaction.

Cut the vector and the two fragments with SacI, XhoI and SpeI, ligate them together, and hopefully *fingers crossed* we'll have our shiny new biobricked promoter.

• Testing the promoter:

Because the cI binding site is being transferred in its entirety, we will assume that the cI will bind to it and repress it properly. So all we need to check is:

-That the promoter works. By putting it into an E. coli strain that's missing lacI and lacZ, to see if the lacZ attached to the promoter is expressed. This can be done quickly if we put x-gal into the growth medium - leave the cells to grow and see if they turn blue.

-That the promoter is repressed by LacI. Put the construct into an E. coli cell that expresses LacI constitutively, but is missing the lacZ gene. Then grow one set of colonies on a medium that contains IPTG + x-gal (should allow lacZ expression) and another on a medium containing x-gal, but no IPTG (shouldn't allow lacZ expression). If all goes according to plan, the colonies on the first one should be blue, and on the second one should be white.

7th August 2006

Of the 12 minipreps prepared for the ars + 4U(lacZ) constructs, only one appeared to have been sucessful, and this was preserved by plating and overnight incubation till tomorrow. Tomorrow the ars + 3U and ars + 4U constructs will be compared to verify.

The lambda cI (5G) plasmid from the iGEM plates was successfully transformed into E.coli, but there were problems with the lamda cI promoter (9C) plasmid: few colonies grew upon transformation, and upon analysis on the gel the bands indicating the plasmid were very faint.

To be done in the following days

To do list for while Judith is away - she expects everything to be finished on her return from Serbia ;)

Primers ordered for lambda cI promoter, and the urease. These can be transformed into cells, once they have been PCR-ed.

The lambda cI promoter needs to be biobricked beside the urease gene.

ArsR which we have already biobricked with lacZ can be biobricked beside the lambda cI repressor protein to result in a construct which has an alkaline pH when arsenic is not present and a neutral/acidic pH when arsenic is present.

Upstairs, tests tests tests.

So.

1. PCR using primers for lambda cI promoter and urease gene.
2. Digests and minipreps etc. to obtain two constructs, one with the arsenic promoter and the lambda cI repressor and one with the urease gene and the lambda cI promoter.
3. Both constructs need to be in the same cell. Could put them all in a row or on two different plasmids.

4th August 2006

Ligations of the Ars promoter insert with the 4U lacZ plasmid were repeated today in the hopes of getting it to work this time around. The ligated plasmid was then transformed into competent cells and plated, and individual cultures will be prepared during the weekend.

In addition, two new plasmids from the iGEM plates were transformed and plated :

On Monday it will be seen if any of these transformations have worked, and hopefully our lucky streak will come back.

3rd August 2006

Minipreps were carried out on the new colonies containing the 4U plasmid with the Ars insert, and the gel showed that the ligation did not work in any of these colonies either. We are digesting another 4U vector with EcoRI and XbaI to see if we can obtain a working construct for this form of the lacZ gene.

We do however, have two plates of colonies of the Ars insert sucessfully ligated by the 3U version of the lacZ. Get in. Now to see if they work.

2nd August 2006

Minipreps were carried out on last night's cultures, and the inserts cut out with EcoRI and PstI. Gel analysis revealed that the ligations were not very successful (there goes our lucky streak in the lab), but 2 of the minipreps were successful and those colonies were streaked on to fresh agar plates. Some more colonies (12) will be grown overnight for further miniprepping tomorrow.

Tentatively, we can say we have our simple construct for the arsenic biosensor project ready to test.

1st August 2006

12 colonies were picked from yesterday's transformations and placed into media for overnight incubation.

[http://2006.igem.org/Lab_Work_July July]

[http://2006.igem.org/Standard_Protocols Standard Protocols]

[http://2006.igem.org/University_of_Edinburgh_2006 Main page]