Phase 1: PCR Amplification of Genes
From 2006.igem.org
(Difference between revisions)
PeterNguyen (Talk | contribs) |
|||
Line 1: | Line 1: | ||
- | + | '''A. Isolating genes for the quorum sensing mechanism from genomic ''B. subtilis'' DNA''' | |
+ | 1. ComX - pheromone, 168bp | ||
+ | Primers: Fwd = CGGAATTCGCTCTAGATGCAAGACCTAATTAACTACTTTTTAAATTATCC | ||
+ | Rev = GACTGCAGCTACTAGTTAATCACCCCATTGACGGGTTATTGG | ||
+ | Notes: | ||
+ | Forward primer contains EcoRI and XbaI cut sites; Reverse primer contains SpeI and PstI cut sites | ||
+ | Amplification of ComX alone was unsuccessful. However, ComQ and ComX are adjacent on the genome so we subsequently amplified them together |
Revision as of 20:45, 23 October 2006
A. Isolating genes for the quorum sensing mechanism from genomic B. subtilis DNA
1. ComX - pheromone, 168bp Primers: Fwd = CGGAATTCGCTCTAGATGCAAGACCTAATTAACTACTTTTTAAATTATCC Rev = GACTGCAGCTACTAGTTAATCACCCCATTGACGGGTTATTGG Notes: Forward primer contains EcoRI and XbaI cut sites; Reverse primer contains SpeI and PstI cut sites Amplification of ComX alone was unsuccessful. However, ComQ and ComX are adjacent on the genome so we subsequently amplified them together