Phase 1: PCR Amplification of Genes
From 2006.igem.org
(Difference between revisions)
m |
m (finished ComQX section) |
||
| Line 1: | Line 1: | ||
'''A. Isolating genes for the quorum sensing mechanism from genomic ''B. subtilis'' DNA''' | '''A. Isolating genes for the quorum sensing mechanism from genomic ''B. subtilis'' DNA''' | ||
| - | # | + | #ComQX: ComQ = 900bp, required accesory protein for ComX production. ComX = 168bp, pheromone |
| - | ::*Primers: Fwd = | + | ::*Primers: |
| - | + | :::Fwd = CGGAATTCCCTCTAGATGAAGGAGATTGTGGAGCAAACATATTTAACG | |
| + | :::Rev = GACTGCAGCTACTAGTTAATCACCCCATTGACGGGTTATTGG | ||
::*Notes: | ::*Notes: | ||
:::Forward primer contains EcoRI and XbaI cut sites; Reverse primer contains SpeI and PstI cut sites | :::Forward primer contains EcoRI and XbaI cut sites; Reverse primer contains SpeI and PstI cut sites | ||
:::Amplification of ComX alone was unsuccessful. However, ComQ and ComX are adjacent on the genome so we subsequently amplified them together | :::Amplification of ComX alone was unsuccessful. However, ComQ and ComX are adjacent on the genome so we subsequently amplified them together | ||
| + | :::Series of DNA gel purifications (Xymo extraction) and PCR amplifications necessary to obtain sufficient quantity. | ||
Revision as of 21:00, 23 October 2006
A. Isolating genes for the quorum sensing mechanism from genomic B. subtilis DNA
- ComQX: ComQ = 900bp, required accesory protein for ComX production. ComX = 168bp, pheromone
- Primers:
- Fwd = CGGAATTCCCTCTAGATGAAGGAGATTGTGGAGCAAACATATTTAACG
- Rev = GACTGCAGCTACTAGTTAATCACCCCATTGACGGGTTATTGG
- Notes:
- Forward primer contains EcoRI and XbaI cut sites; Reverse primer contains SpeI and PstI cut sites
- Amplification of ComX alone was unsuccessful. However, ComQ and ComX are adjacent on the genome so we subsequently amplified them together
- Series of DNA gel purifications (Xymo extraction) and PCR amplifications necessary to obtain sufficient quantity.
