Biobricks

From 2006.igem.org

(Difference between revisions)
Jump to: navigation, search
Line 6: Line 6:
| '''Parts''' || '''Part No.''' || '''Function''' || '''Status'''
| '''Parts''' || '''Part No.''' || '''Function''' || '''Status'''
|-
|-
-
| E. coli ArsR to LacZ || J33203 || pH lowering output in response to raised arsenate concentration || Not Working
+
| E. coli ArsR to LacZ || J33203 || pH lowering output in response to raised arsenate concentration || Working
|-  
|-  
-
| B. subtilis ArsR to LacZ || J33206 || As Above || Doing again with correct lacZ
+
| B. subtilis ArsR to LacZ || J33206 || As Above || Background activity too high
|-
|-
| B. subtilis ArsR to lambda cI repressor || n/a|| To repress the hybrid promoter in response to lower levels of arsenate || Done but untested
| B. subtilis ArsR to lambda cI repressor || n/a|| To repress the hybrid promoter in response to lower levels of arsenate || Done but untested
Line 23: Line 23:
| E. coli ArsR || J33201 || Complete || To LacZ || Working || Done || Detection of Arsenic
| E. coli ArsR || J33201 || Complete || To LacZ || Working || Done || Detection of Arsenic
|-
|-
-
| B. subtilis ArsR || n/a ||  Complete || To LacZ || Tests Underway || SpeI site not correct, not in biobrick form  || Detection of Arsenic
+
| B. subtilis ArsR || n/a ||  Complete || To LacZ || Tests Underway || biobrick suffix not correct, not in biobrick form  || Detection of Arsenic
|-
|-
| LacZ' || J33202 || Complete || To ArsR and Terminator || Working || Done || Lowering pH/Reporting
| LacZ' || J33202 || Complete || To ArsR and Terminator || Working || Done || Lowering pH/Reporting
|-
|-
-
| Bacillus Urease || n/a || Site specific mutagenesis required || To ligate to hybrid promoter || N/A || Not Yet || Raising pH
+
| Bacillus Urease || n/a || Site specific mutagenesis required to remove EcoRI and SpeI sites || To ligate to hybrid promoter || N/A || Not Yet || Raising pH
|-
|-
| lambda cI/lacI Promoter || J33205 ||  Complete || To ligate to urease || Planned || Done || Repressed by lambda cI and lacI in absence of lactose
| lambda cI/lacI Promoter || J33205 ||  Complete || To ligate to urease || Planned || Done || Repressed by lambda cI and lacI in absence of lactose

Revision as of 13:36, 27 October 2006

Construction So Far

Devices Created

Parts Part No. Function Status
E. coli ArsR to LacZ J33203 pH lowering output in response to raised arsenate concentration Working
B. subtilis ArsR to LacZ J33206 As Above Background activity too high
B. subtilis ArsR to lambda cI repressor n/a To repress the hybrid promoter in response to lower levels of arsenate Done but untested
GFP to Terminator n/a Testing ArsR function if can't get pH response Done but not ligated to either ArsR

Biobricks Constructed By Us

Biobrick Part No. Construction Ligations Testing Sequencing Use
E. coli ArsR J33201 Complete To LacZ Working Done Detection of Arsenic
B. subtilis ArsR n/a Complete To LacZ Tests Underway biobrick suffix not correct, not in biobrick form Detection of Arsenic
LacZ' J33202 Complete To ArsR and Terminator Working Done Lowering pH/Reporting
Bacillus Urease n/a Site specific mutagenesis required to remove EcoRI and SpeI sites To ligate to hybrid promoter N/A Not Yet Raising pH
lambda cI/lacI Promoter J33205 Complete To ligate to urease Planned Done Repressed by lambda cI and lacI in absence of lactose

Parts constructed but not used

Biobrick Part No. Function
xylE from Psuedomonas putida J33204 Reporter converting catechol to yellow colour


Biobricks Taken From Registry

Biobrick Number and Location Ligations Testing Use
Terminator BBa_B0015, 1I To LacZ, plasmid used as vector for most ligations N/A Terminating
RBS BBa_B0034, 3O To ArsR from E. coli N/A Ribosome binding site
lambda cI BBa_R0051, 9C Not yet Not yet Repressing hybrid promoter
GFP BBa_E0040, 5H To Terminator Not Yet Testing Promoters

Primers Etc.

All biobricks have to have the following:

Prefix

(5’) cctttctagag (3’)

Suffix

(5’) tactagtagcggccgctgcagcctt (3’)

[http://2006.igem.org/University_of_Edinburgh_2006 Main page]

Retrieved from "http://2006.igem.org/wiki/index.php/Biobricks"
Personal tools
Past/present/future years