IGEM 2005 Awards

From 2006.igem.org

Revision as of 16:09, 7 November 2005

Princeton Best Plasmid Naming Scheme Best "Show Must Go On" Moment Best Honest Answer Best Simulation of a Simulation

Oklahoma Best "Hail Mary" Cloning Best "Quantitative" Answer Feynman's Teaching Award

ETH Best Wiki Award Most Sensitive Super Model Award Precision Engineering Award

MIT Most Modest Goal Least Transportable Visual Aid Best Analogy Second Most Parts Award

Caltech Best Use of Transmogrified Smiley Faces Best New Application Area Best New New Foundational Research Area Chuck D.'s Choice Award

Toronto Best Project Name (Cell-See-Us) Most Direct Use of Logic Best Advice Nothing-Will-Stop-Us Award

Cambridge Most Effective Approach Best Master of Ceremonies Marshall Cultural Exchange Award Best Data & Data Visuals Best Uniforms

Texas Best Confession / Negative Control (One Year Late) Best Live Demo, Again Best Model-Driven Design Best Proposed Funding Mechanism

Penn State Best Brick Award (BBa_S03271, MotB) Best New Sport (Beijing 2008 or bust!) Best Use of Metaphor

Berkeley Red-Eye Award XXXtreme Presentation Best Conceptual Advance Most Innovative Brick Award (BBa_J01002)

Davidson Best Team Name (SynthAces) Best Debuggers Best Interface Logic

Harvard Best Part Numbers Most Organized Presentation Best Technology Integration Award Most Parts Award Best TAATACGACTCACTATAGGGAGA Award Best Use of Redundancy

UCSF Coolest Part Most Innovative Abuse of Expensive Laboratory Equipment Best Device Award Most Thoughtful Approach

Highlights (some of the things that worked) Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch) Texas - Working and improved bacterial photography and signal processing device (built from BioBricks) Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet) MIT - Iron-induced control of any BioBrick device Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB) Harvard - write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires." UCSF - wanted biological temperature detector, got a programmable biological thermometer