Hin gene: Part BBa J31000
From 2006.igem.org
(Difference between revisions)
Fizzle6821 (Talk | contribs) |
Fizzle6821 (Talk | contribs) |
||
| Line 1: | Line 1: | ||
| - | '''''Hin gene: Part BBa_J31000''''' | + | '''''Hin gene: Part BBa_J31000'''''[http://partsregistry.org/Part:BBa_J31000] |
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in,<font color='blue'>blue</font color>. | Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in,<font color='blue'>blue</font color>. | ||
Revision as of 18:47, 12 June 2006
Hin gene: Part BBa_J31000[http://partsregistry.org/Part:BBa_J31000]
Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in,blue.
Forward primer
5’ GCATTCTAGAATGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGATTTACAGCGTAATGCGCTTACCAGTGCAAATTG 3’
Reverse primer
5’ ATGCCTGCAGGCGGCCGCACTAGTTTAATTCATTCGTTTTTTTATAC 3’
