Biobricks

From 2006.igem.org

Revision as of 12:05, 29 August 2006 by Judenich (Talk | contribs)
Jump to: navigation, search

Construction So Far

Devices Created

Parts Function Status
E. coli ArsR to LacZ pH lowering output in response to raised arsenate concentration Not Working
B. subtilis ArsR to LacZ As Above Doing again with correct lacZ
B. subtilis ArsR to lambda cI repressor To repress the hybrid promoter in response to lower levels of arsenate Done but untested
GFP to Terminator Testing ArsR function if can't get pH response Done but not ligated to either ArsR

Biobricks Constructed By Us

Biobrick Construction Ligations Testing Sequencing Use
E. coli ArsR Complete To LacZ Not Working Not Yet Detection of Arsenic
B. subtilis ArsR Complete To LacZ Not Tested Not Yet Detection of Arsenic
LacZ Complete To ArsR and Terminator Tests Underway Not Yet Lowering pH/Reporting
Bacillus Urease Site specific mutagenesis required To ligate to hybrid promoter N/A Not Yet Raising pH
lambda cI/lacI Promoter Underway To ligate to urease N/A Not yet Repressed by lambda cI and lacI in absence of lactose

Biobricks Taken From Registry

Biobrick Number and Location Ligations Testing Use
Terminator BBa_B0015, 1I To LacZ, plasmid used as vector for most ligations N/A Terminating
RBS BBa_B0034, 3O To ArsR from E. coli N/A Ribosome binding site
lambda cI BBa_R0051, 9C Not yet Not yet Repressing hybrid promoter

Primers Etc.

All biobricks have to have the following:

Prefix

(5’) cctttctagag (3’)

Suffix

(5’) tactagtagcggccgctgcagcctt (3’)

[http://2006.igem.org/University_of_Edinburgh_2006 Main page]

Personal tools
Past/present/future years