IGEM 2005 Awards

From 2006.igem.org

Revision as of 12:03, 24 November 2005 by 129.132.12.245 (Talk)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

The following awards were given out at the 2005 Jamboree by the Awards Panel

  • Princeton
    • Best Plasmid Naming Scheme
    • Best "Show Must Go On" Moment
    • Best Honest Answer
    • Best Simulation of a Simulation
  • Oklahoma
    • Best "Hail Mary" Cloning
    • Best "Quantitative" Answer
    • Feynman's Teaching Award
  • ETH
    • Best Wiki Award
    • Most Sensitive Super Model Award
    • Precision Engineering Award
    • George W. Bush Geography Award
  • MIT
    • Most Modest Goal
    • Least Transportable Visual Aid
    • Best Analogy
    • Second Most Parts Award
    • IKEA Idea Award
  • Caltech
    • Best Use of Transmogrified Smiley Faces
    • Best New Application Area
    • Best New New Foundational Research Area
    • Chuck D.'s Choice Award
  • Toronto
    • Best Project Name (Cell-See-Us)
    • Most Direct Use of Logic
    • Best Advice
    • Nothing-Will-Stop-Us Award
  • Cambridge
    • Most Effective Approach
    • Best Master of Ceremonies
    • Marshall Cultural Exchange Award
    • Best Data & Data Visuals
    • Best Uniforms
  • Texas
    • Best Confession / Negative Control (One Year Late)
    • Best Live Demo, Again
    • Best Model-Driven Design
    • Best Proposed Funding Mechanism
  • Penn State
    • Best Brick Award (BBa_S03271, MotB)
    • Best New Sport (Beijing 2008 or bust!)
    • Best Use of Metaphor
  • Berkeley
    • Red-Eye Award
    • XXXtreme Presentation
    • Best Conceptual Advance
    • Most Innovative Brick Award (BBa_J01002)
  • Davidson
    • Best Team Name (SynthAces)
    • Best Debuggers
    • Best Interface Logic
  • Harvard
    • Best Part Numbers
    • Most Organized Presentation
    • Best Technology Integration Award
    • Most Parts Award
    • Best TAATACGACTCACTATAGGGAGA Award
    • Best Use of Redundancy
  • UCSF
    • Coolest Part
    • Most Innovative Abuse of Expensive Laboratory Equipment
    • Best Device Award
    • Most Thoughtful Approach

Highlights (some of the things that worked)

  • Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch)
  • Texas - Working and improved bacterial photography and signal processing device (built from BioBricks)
  • Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet)
  • MIT - Iron-induced control of any BioBrick device
  • Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB)
  • Harvard - Write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires."
  • UCSF - Wanted biological temperature detector, got a programmable biological thermometer
Personal tools
Past/present/future years