Biobricks

Revision as of 11:57, 23 October 2006 by Judenich (Talk | contribs)

Construction So Far

Parts	Function	Status
E. coli ArsR to LacZ	pH lowering output in response to raised arsenate concentration	Not Working
B. subtilis ArsR to LacZ	As Above	Doing again with correct lacZ
B. subtilis ArsR to lambda cI repressor	To repress the hybrid promoter in response to lower levels of arsenate	Done but untested
GFP to Terminator	Testing ArsR function if can't get pH response	Done but not ligated to either ArsR

Biobrick	Construction	Ligations	Testing	Sequencing	Use
E. coli ArsR	Complete	To LacZ	Working	Done	Detection of Arsenic
B. subtilis ArsR	Complete	To LacZ	Tests Underway	Done	Detection of Arsenic
LacZ	Complete	To ArsR and Terminator	Working	Done	Lowering pH/Reporting
Bacillus Urease	Site specific mutagenesis required	To ligate to hybrid promoter	N/A	Not Yet	Raising pH
lambda cI/lacI Promoter	Complete	To ligate to urease	Planned	Done	Repressed by lambda cI and lacI in absence of lactose

Biobrick	Number and Location	Ligations	Testing	Use
Terminator	BBa_B0015, 1I	To LacZ, plasmid used as vector for most ligations	N/A	Terminating
RBS	BBa_B0034, 3O	To ArsR from E. coli	N/A	Ribosome binding site
lambda cI	BBa_R0051, 9C	Not yet	Not yet	Repressing hybrid promoter
GFP	BBa_E0040, 5H	To Terminator	Not Yet	Testing Promoters

All biobricks have to have the following:

Prefix

(5’) cctttctagag (3’)

Suffix

(5’) tactagtagcggccgctgcagcctt (3’)

[http://2006.igem.org/University_of_Edinburgh_2006 Main page]