Biobricks

Revision as of 09:28, 25 October 2006 by Judenich (Talk | contribs)

Construction So Far

Parts	Part No.	Function	Status
E. coli ArsR to LacZ	J33203	pH lowering output in response to raised arsenate concentration	Not Working
B. subtilis ArsR to LacZ	J33206	As Above	Doing again with correct lacZ
B. subtilis ArsR to lambda cI repressor	n/a	To repress the hybrid promoter in response to lower levels of arsenate	Done but untested
GFP to Terminator	n/a	Testing ArsR function if can't get pH response	Done but not ligated to either ArsR

Biobrick	Part No.	Construction	Ligations	Testing	Sequencing	Use
E. coli ArsR	J33201	Complete	To LacZ	Working	Done	Detection of Arsenic
B. subtilis ArsR	n/a	Complete	To LacZ	Tests Underway	SpeI site not correct, not in biobrick form	Detection of Arsenic
LacZ'	J33202	Complete	To ArsR and Terminator	Working	Done	Lowering pH/Reporting
Bacillus Urease	n/a	Site specific mutagenesis required	To ligate to hybrid promoter	N/A	Not Yet	Raising pH
lambda cI/lacI Promoter	J33205	Complete	To ligate to urease	Planned	Done	Repressed by lambda cI and lacI in absence of lactose

Biobrick

Function

Biobrick	Number and Location	Ligations	Testing	Use
Terminator	BBa_B0015, 1I	To LacZ, plasmid used as vector for most ligations	N/A	Terminating
RBS	BBa_B0034, 3O	To ArsR from E. coli	N/A	Ribosome binding site
lambda cI	BBa_R0051, 9C	Not yet	Not yet	Repressing hybrid promoter
GFP	BBa_E0040, 5H	To Terminator	Not Yet	Testing Promoters

All biobricks have to have the following:

Prefix

(5’) cctttctagag (3’)

Suffix

(5’) tactagtagcggccgctgcagcctt (3’)

[http://2006.igem.org/University_of_Edinburgh_2006 Main page]