Biobricks

From 2006.igem.org

Revision as of 13:20, 29 October 2006 by Cfrench (Talk | contribs)
Jump to: navigation, search

Construction So Far

Devices Created

Parts Part No. Function Status
E. coli ArsR to LacZ J33203 pH lowering output in response to raised arsenate concentration Working
B. subtilis ArsR to LacZ J33206 As Above Background activity too high
B. subtilis ArsR to lambda cI repressor n/a To repress the hybrid promoter in response to lower levels of arsenate Done but untested
GFP to Terminator n/a Testing ArsR function if can't get pH response Done but not ligated to either ArsR

Biobricks Constructed By Us

Biobrick Part No. Construction Ligations Testing Sequencing Use
E. coli ArsR J33201 Complete To LacZ Working Done Detection of Arsenic
B. subtilis ArsR n/a Complete To LacZ Tests Underway biobrick suffix not correct, not in biobrick form Detection of Arsenic
LacZ' J33202 Complete To ArsR and Terminator Working Done Lowering pH/Reporting
Bacillus Urease n/a Site specific mutagenesis required to remove EcoRI and SpeI sites To ligate to hybrid promoter N/A Not Yet Raising pH
lambda cI/lacI Promoter J33205 Complete To ligate to urease Planned Done Repressed by lambda cI and lacI in absence of lactose

Parts constructed but not used

Biobrick Part No. Function
xylE from Psuedomonas putida J33204 Reporter converting catechol to yellow colour


Biobricks Taken From Registry

Biobrick Number and Location Ligations Testing Use
Terminator BBa_B0015, 1I To LacZ, plasmid used as vector for most ligations N/A Terminating
RBS BBa_B0034, 3O To ArsR from E. coli N/A Ribosome binding site
lambda cI BBa_R0051, 9C Not yet Not yet Repressing hybrid promoter
GFP BBa_E0040, 5H To Terminator Not Yet Testing Promoters

Primers Etc.

All biobricks have to have the following:

Prefix

(5’) cctttctagag (3’)

Suffix

(5’) tactagtagcggccgctgcagcctt (3’)

Primers used in our procedures

Name Sequence Use Worked? Sites
Ecarsf1cctttctagagccaactcaaaattcac E. coli arsR for J33201 yes XbaI
Ecarsr1aaggctgcagcggccgctactagtacccggataaaacacatc E. coli arsR for J33201 yes SpeI, NotI, PstI
laczf1cctttctagaggaggaaacagctatgacc E. coli lacZ' for J33202 yes XbaI
laczr1aaggctgcagcggccgctactagtatcactccagccagctttc E. coli lacZ' for J33202 yes SpeI, NotI, PstI
laczf2ggtctagagctcatgttatatcccg E. coli lacZ' for J33207 yes XbaI, SacI
Bsarsf2atgagctccgttgctgtagtagc B. subtilis arsR for J33206 yes SacI
Bsarsr2aaactagtttagcagcaatctccttc B. subtilis arsR for J33206 yes SpeI
Ppxylef2ctgagctcatgaactatgaagaggtg P. putida xylE for J33204 yes SacI
Ppxyler2taactagtaccggaccatcaggtc P. putida xylE for J33204 yes SpeI


[http://2006.igem.org/University_of_Edinburgh_2006 Main page]

Personal tools
Past/present/future years