Davidson Parts

From 2006.igem.org

Hin gene: Part BBa_J31000

Primers for Hin gene the 72nd base was mutated from a "T" to a "C" in order to remove a naturally occuring SpeI site. The mutatation is in bold.

Forward primer

5’ gcattctagaatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttacCagtgcaaattg 3’

Reverse primer

5’ atgcctgcaggcggccgcactagtttaattcattcgtttttttatac 3’

Hin gene with LVA degredation tag

Will have the following primers synthesized so that the Hin gene has a LVA degredation tag.

Forward Primer

• Consists of a BioBrick prefix, four base pairs from plasmid pSB1A2 [http://partsregistry.org/Part:pSB1A2], and the first three base pairs of the Hin gene

TCTGGAATTCGCGGCCGCATCTAGAGATG

Reverse Primer

• Consists of the Bio Brick suffix, Stop codon, LVA tag and the ,last 20 base pairs of the Hin gene (without the stop codon)

CTGCAGGCGGCCGCTACTAGTATTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC

[Recombinational Enahancer: Part BBa_J3101] Recombinational Enhancer: Part BBa_J3101

These are the oligos that we ordered to make the recombinational enhancer.

AATTCGCGGCCGCTTCTAGATTCGGGTGTCAACAATTGACCAAAATAT

CGATTTACAGCGTAATGCGCTTTCTAGTGCAAATTGTGACCGC

ATTTTACTAGTTGCGGCCGCCTGCA

GGCGGCCGCAACTAGTAAAATGCGGTCACAATTTGCACTAGAA

AGCGCATTACGCTGTAAATCGATATTTTGGTCAATTGTTGACACCCGAATCTAGAAGCGGCCGCG