Biobricks

From 2006.igem.org

Revision as of 14:51, 6 July 2006 by Jenwilson (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

All biobricks have to have the following:

Prefix (5’) cctttctagag (3’)
Suffix (5’) tactagtagcggccgctgcagcctt (3’)

ArsR with Ribosome Binding Site Biobrick

Front primer sequence with Biobrick prefix


(5’) cctttctagag ccaactcaaaattcacac (3’)


Back primer sequence with Biobrick suffix


(5’) tactagtagcggccgctgcagcctt catatgtgtttagc (3’)

LacZ with Ribosome Binding Site Biobrick

Front primer sequence with Biobrick prefix


(5’) cctttctagag gaaacagctatgaccatg (3’)


Back primer sequence with Biobrick suffix


(5’) tactagtagcggccgctgcagcctt gaggggacgacgacag (3’)

Personal tools
Past/present/future years